\
| Variant ID: vg0719452729 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19452729 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACTAGAAAAGCCATATCCTCATATTCTTCCTTCTTCCTGTGGACATCTAGCCGCATGCAGGCTCTGCCATTGTTGCCCGCATGTCGGCTTGCTGGGGAC[G/A]
TCGCCGATGGCCGGCTCAGATGGTGTTGCGGTCGATGCGGCGAGAAAATGACTCCCGGTGGCCAGCGGCTAGTGGTCGTGGGCGCAGAGAGGGGGACAGA
TCTGTCCCCCTCTCTGCGCCCACGACCACTAGCCGCTGGCCACCGGGAGTCATTTTCTCGCCGCATCGACCGCAACACCATCTGAGCCGGCCATCGGCGA[C/T]
GTCCCCAGCAAGCCGACATGCGGGCAACAATGGCAGAGCCTGCATGCGGCTAGATGTCCACAGGAAGAAGGAAGAATATGAGGATATGGCTTTTCTAGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 7.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 76.80% | 23.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 82.70% | 17.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 57.70% | 42.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719452729 | G -> A | LOC_Os07g32620.1 | downstream_gene_variant ; 1762.0bp to feature; MODIFIER | silent_mutation | Average:62.729; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0719452729 | G -> A | LOC_Os07g32610-LOC_Os07g32620 | intergenic_region ; MODIFIER | silent_mutation | Average:62.729; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719452729 | 5.37E-08 | NA | mr1076 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 5.57E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 5.18E-09 | NA | mr1226 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | NA | 4.08E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 2.82E-06 | NA | mr1070_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 2.10E-06 | 2.10E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 1.22E-08 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 5.73E-14 | NA | mr1083_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | NA | 1.84E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 6.12E-09 | NA | mr1085_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 6.76E-09 | NA | mr1103_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 1.24E-10 | NA | mr1104_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 1.69E-12 | NA | mr1107_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 7.29E-08 | NA | mr1145_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 1.61E-09 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 1.61E-07 | NA | mr1264_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719452729 | 8.89E-10 | 1.22E-14 | mr1408_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |