\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719451062:

Variant ID: vg0719451062 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19451062
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATATTGGGTTCTTATATGGACTCTTCTTTCAATATTCTTTATTTTTAATTACGAATTTCAGTTATTTTTAAATTGTATTCCTACTTGGACTCTCATTTT[C/A]
TTTTCTAATTTTATATTTTATTTTATTTTTATTCCGAATTTTGATTAATCTCGTATTGAGTTCTTATATGGACTCTTCTTTCTATATTGCTTATTTTTAA

Reverse complement sequence

TTAAAAATAAGCAATATAGAAAGAAGAGTCCATATAAGAACTCAATACGAGATTAATCAAAATTCGGAATAAAAATAAAATAAAATATAAAATTAGAAAA[G/T]
AAAATGAGAGTCCAAGTAGGAATACAATTTAAAAATAACTGAAATTCGTAATTAAAAATAAAGAATATTGAAAGAAGAGTCCATATAAGAACCCAATATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 4.00% 0.00% 0.00% NA
All Indica  2759 93.50% 6.50% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.60% 6.40% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 94.70% 5.30% 0.00% 0.00% NA
Indica Intermediate  786 90.30% 9.70% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719451062 C -> A LOC_Os07g32620.1 downstream_gene_variant ; 3429.0bp to feature; MODIFIER silent_mutation Average:17.1; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0719451062 C -> A LOC_Os07g32610-LOC_Os07g32620 intergenic_region ; MODIFIER silent_mutation Average:17.1; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719451062 NA 4.67E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062 5.74E-07 5.24E-09 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062 1.90E-06 4.44E-06 mr1103 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062 NA 2.84E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062 3.52E-06 3.63E-08 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062 1.62E-07 1.60E-09 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062 NA 2.46E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062 2.77E-07 3.56E-08 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062 2.26E-06 8.50E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251