Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0719443406:

Variant ID: vg0719443406 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19443406
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATAGTCAAAGTTATATAATTTGGGTCAAAACTTTTGGCCAAAAACTTTTAGATGTAATTATAGTATAACTGAAGTGTAATTACATTGTAACTACACT[G/A]
TAACTATGATATAACTTATTAAAACTTGCATTCAACGATAAGTTGGTTAGATAACACTGGGATTTTATGTGTGACATGTGCGAAAAAAATTTTTAGCAAT

Reverse complement sequence

ATTGCTAAAAATTTTTTTCGCACATGTCACACATAAAATCCCAGTGTTATCTAACCAACTTATCGTTGAATGCAAGTTTTAATAAGTTATATCATAGTTA[C/T]
AGTGTAGTTACAATGTAATTACACTTCAGTTATACTATAATTACATCTAAAAGTTTTTGGCCAAAAGTTTTGACCCAAATTATATAACTTTGACTATCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 25.80% 0.08% 0.00% NA
All Indica  2759 92.20% 7.70% 0.07% 0.00% NA
All Japonica  1512 35.90% 64.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.10% 6.90% 0.00% 0.00% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 94.30% 5.60% 0.11% 0.00% NA
Indica Intermediate  786 88.00% 11.80% 0.13% 0.00% NA
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 79.20% 20.80% 0.00% 0.00% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 70.00% 27.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719443406 G -> A LOC_Os07g32600.1 downstream_gene_variant ; 630.0bp to feature; MODIFIER silent_mutation Average:52.348; most accessible tissue: Minghui63 flower, score: 69.56 N N N N
vg0719443406 G -> A LOC_Os07g32610.2 downstream_gene_variant ; 772.0bp to feature; MODIFIER silent_mutation Average:52.348; most accessible tissue: Minghui63 flower, score: 69.56 N N N N
vg0719443406 G -> A LOC_Os07g32600.2 downstream_gene_variant ; 4075.0bp to feature; MODIFIER silent_mutation Average:52.348; most accessible tissue: Minghui63 flower, score: 69.56 N N N N
vg0719443406 G -> A LOC_Os07g32610.1 downstream_gene_variant ; 772.0bp to feature; MODIFIER silent_mutation Average:52.348; most accessible tissue: Minghui63 flower, score: 69.56 N N N N
vg0719443406 G -> A LOC_Os07g32600-LOC_Os07g32610 intergenic_region ; MODIFIER silent_mutation Average:52.348; most accessible tissue: Minghui63 flower, score: 69.56 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719443406 NA 3.68E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.25E-07 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 2.71E-07 3.54E-08 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 2.18E-09 NA mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 6.06E-10 3.09E-11 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.79E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 9.75E-08 5.20E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.82E-08 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.25E-06 1.47E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 2.24E-06 NA mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 5.25E-07 NA mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 2.17E-07 1.48E-34 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.35E-07 NA mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 4.31E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.26E-06 NA mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 4.76E-07 9.34E-09 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.56E-07 NA mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.70E-09 6.94E-11 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 2.20E-06 NA mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 5.67E-07 5.12E-13 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.94E-07 1.20E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.41E-08 NA mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.31E-08 1.98E-09 mr1246 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 7.31E-06 NA mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 3.26E-08 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 8.61E-08 NA mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.93E-08 1.68E-08 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 6.39E-07 NA mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.57E-06 2.50E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 1.38E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 2.92E-06 1.25E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 4.10E-06 1.67E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 9.93E-06 2.62E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.78E-09 NA mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.21E-07 2.31E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 6.70E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 7.02E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.36E-06 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 5.34E-13 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 8.06E-10 7.50E-36 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 4.17E-06 1.15E-06 mr1224_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 1.44E-08 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 2.02E-06 NA mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.02E-10 NA mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 3.98E-07 3.07E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 1.52E-09 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.32E-09 NA mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 4.39E-06 1.22E-06 mr1404_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 9.98E-08 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 1.70E-08 NA mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 6.03E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719443406 NA 1.33E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251