Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719072257:

Variant ID: vg0719072257 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 19072257
Reference Allele: A	Alternative Allele: G,T,ACGCCCTGAAGTTCCCCTCCCTTGCTCTAAAGT
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAATACGACGCAACAATCCATTAACGGGTGTATCATCTTCCTAATGGTTAGCACTGATACTTGTCTTCCTAATGCAGTATATAATCAACACACATATTG[A/G,T,ACGCCCTGAAGTTCCCCTCCCTTGCTCTAAAGT]
CATTTTGAAGCAATTGTGCAGGCAAAATATTTCAGCAAACTCGTGATACGGAAGGTTGGGATCACGAGTGTTAAATCATGCCACATTTCTTAGTTCGAGG

Reverse complement sequence

CCTCGAACTAAGAAATGTGGCATGATTTAACACTCGTGATCCCAACCTTCCGTATCACGAGTTTGCTGAAATATTTTGCCTGCACAATTGCTTCAAAATG[T/C,A,ACTTTAGAGCAAGGGAGGGGAACTTCAGGGCGT]
CAATATGTGTGTTGATTATATACTGCATTAGGAAGACAAGTATCAGTGCTAACCATTAGGAAGATGATACACCCGTTAATGGATTGTTGCGTCGTATTCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	4.30%	5.33%	0.25%	T: 0.36%; ACGCCCTGAAGTTCCCCTCCCTTGCTCTAAAGT: 0.06%
All Indica	2759	99.20%	0.30%	0.43%	0.00%	T: 0.07%
All Japonica	1512	71.60%	12.40%	14.09%	0.73%	T: 0.99%; ACGCCCTGAAGTTCCCCTCCCTTGCTCTAAAGT: 0.20%
Aus	269	98.50%	0.00%	1.49%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.10%	1.50%	0.22%	0.00%	T: 0.22%
Indica III	913	99.80%	0.00%	0.22%	0.00%	NA
Indica Intermediate	786	98.70%	0.00%	1.15%	0.00%	T: 0.13%
Temperate Japonica	767	97.50%	0.00%	2.09%	0.26%	ACGCCCTGAAGTTCCCCTCCCTTGCTCTAAAGT: 0.13%
Tropical Japonica	504	34.30%	36.50%	25.60%	1.19%	T: 2.18%; ACGCCCTGAAGTTCCCCTCCCTTGCTCTAAAGT: 0.20%
Japonica Intermediate	241	66.80%	1.70%	28.22%	1.24%	T: 1.66%; ACGCCCTGAAGTTCCCCTCCCTTGCTCTAAAGT: 0.41%
VI/Aromatic	96	90.60%	4.20%	4.17%	1.04%	NA
Intermediate	90	76.70%	2.20%	21.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719072257	A -> DEL	N	N	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> G	LOC_Os07g32100.1	upstream_gene_variant ; 1105.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> G	LOC_Os07g32080.1	downstream_gene_variant ; 2883.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> G	LOC_Os07g32110.1	downstream_gene_variant ; 3237.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> G	LOC_Os07g32090.1	intron_variant ; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> ACGCCCTGAAGTTCCCCTCCCTTGCTCTAA AGT	LOC_Os07g32100.1	upstream_gene_variant ; 1104.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> ACGCCCTGAAGTTCCCCTCCCTTGCTCTAA AGT	LOC_Os07g32080.1	downstream_gene_variant ; 2884.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> ACGCCCTGAAGTTCCCCTCCCTTGCTCTAA AGT	LOC_Os07g32110.1	downstream_gene_variant ; 3236.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> ACGCCCTGAAGTTCCCCTCCCTTGCTCTAA AGT	LOC_Os07g32090.1	intron_variant ; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> T	LOC_Os07g32100.1	upstream_gene_variant ; 1105.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> T	LOC_Os07g32080.1	downstream_gene_variant ; 2883.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> T	LOC_Os07g32110.1	downstream_gene_variant ; 3237.0bp to feature; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0719072257	A -> T	LOC_Os07g32090.1	intron_variant ; MODIFIER	silent_mutation	Average:40.674; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719072257	5.52E-11	3.19E-15	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	1.52E-10	8.74E-15	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	1.01E-11	2.28E-15	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	7.72E-09	7.73E-09	mr1085	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	1.40E-07	1.91E-08	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	2.68E-07	6.69E-09	mr1103	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	4.27E-09	1.53E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	1.61E-06	3.58E-08	mr1107	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	4.10E-06	4.10E-06	mr1145	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	7.40E-06	NA	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	6.83E-08	6.83E-08	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	3.90E-11	2.45E-17	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	7.26E-08	1.01E-09	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	1.38E-09	2.85E-10	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	2.38E-08	2.38E-08	mr1436	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	4.21E-07	8.23E-07	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	9.43E-08	3.83E-10	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	NA	2.24E-06	mr1878	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	1.42E-08	1.82E-10	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	1.21E-12	6.17E-11	mr1070_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	3.11E-14	3.11E-14	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	5.32E-18	2.77E-24	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	4.53E-22	3.44E-28	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	5.02E-13	1.29E-12	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	4.50E-06	NA	mr1088_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	6.52E-16	2.59E-17	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	4.37E-15	1.78E-16	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	5.08E-16	1.02E-18	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	2.47E-13	2.47E-13	mr1145_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	3.12E-11	1.25E-08	mr1155_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	2.69E-20	1.33E-26	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	5.88E-06	NA	mr1227_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	4.34E-10	4.34E-10	mr1233_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	6.77E-16	1.11E-19	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	3.08E-11	6.84E-10	mr1437_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	2.44E-07	NA	mr1620_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	8.29E-08	8.29E-08	mr1878_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719072257	1.13E-06	4.72E-07	mr1949_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251