Variant ID: vg0719012268 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 19012268 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAGGGGTAGCGTCAAATTCTCGCCGACTAAGTGCGATGGGTTTCGTTTCTGGCATCGACGACTTCGCCTTCCCCCCGGGCAGGCGTTCCGGTTCGGCAGC[T/C]
TCAACTTCATCACCAATGACTTCGGCAAGATCTCTCTCCTTGACTCGGATTCAAACCAGTCGGGGAGAGACCAGGTCCCCGTGCCATTCGGTATTCCGAA
TTCGGAATACCGAATGGCACGGGGACCTGGTCTCTCCCCGACTGGTTTGAATCCGAGTCAAGGAGAGAGATCTTGCCGAAGTCATTGGTGATGAAGTTGA[A/G]
GCTGCCGAACCGGAACGCCTGCCCGGGGGGAAGGCGAAGTCGTCGATGCCAGAAACGAAACCCATCGCACTTAGTCGGCGAGAATTTGACGCTACCCCTA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 56.90% | 0.30% | 7.96% | 34.91% | NA |
All Indica | 2759 | 47.70% | 0.40% | 11.67% | 40.20% | NA |
All Japonica | 1512 | 74.70% | 0.00% | 2.91% | 22.42% | NA |
Aus | 269 | 56.90% | 0.00% | 0.37% | 42.75% | NA |
Indica I | 595 | 34.10% | 0.20% | 11.76% | 53.95% | NA |
Indica II | 465 | 37.80% | 0.20% | 9.68% | 52.26% | NA |
Indica III | 913 | 62.70% | 0.80% | 10.51% | 26.07% | NA |
Indica Intermediate | 786 | 46.60% | 0.30% | 14.12% | 39.06% | NA |
Temperate Japonica | 767 | 96.70% | 0.00% | 0.00% | 3.26% | NA |
Tropical Japonica | 504 | 45.20% | 0.00% | 7.94% | 46.83% | NA |
Japonica Intermediate | 241 | 66.00% | 0.00% | 1.66% | 32.37% | NA |
VI/Aromatic | 96 | 40.60% | 0.00% | 1.04% | 58.33% | NA |
Intermediate | 90 | 55.60% | 1.10% | 8.89% | 34.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0719012268 | T -> DEL | N | N | silent_mutation | Average:12.71; most accessible tissue: Callus, score: 42.878 | N | N | N | N |
vg0719012268 | T -> C | LOC_Os07g31960.1 | upstream_gene_variant ; 2623.0bp to feature; MODIFIER | silent_mutation | Average:12.71; most accessible tissue: Callus, score: 42.878 | N | N | N | N |
vg0719012268 | T -> C | LOC_Os07g31960-LOC_Os07g31980 | intergenic_region ; MODIFIER | silent_mutation | Average:12.71; most accessible tissue: Callus, score: 42.878 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0719012268 | NA | 4.87E-12 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0719012268 | NA | 1.28E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0719012268 | 3.15E-09 | NA | mr1155_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0719012268 | 2.18E-08 | 1.63E-13 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |