\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719006525:

Variant ID: vg0719006525 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19006525
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTCCTGCGGGTCTCATCTCCCCCCTCCGACCGGCACCAGCTGCTACCGCCGGCGCATCCTCTCCTGCCGCTCCTCTCCACCGCCGAGCTCGCCATCGC[G/A]
TCAGCCGTCTCTCTCCACCTCTCCCGCCGCCGCTGCCCCTGCTCTGCCACCGGCCGCCTCACGCCCCACCGCGCTTGCTCGAGAGAAGGAGAGAAGAGAA

Reverse complement sequence

TTCTCTTCTCTCCTTCTCTCGAGCAAGCGCGGTGGGGCGTGAGGCGGCCGGTGGCAGAGCAGGGGCAGCGGCGGCGGGAGAGGTGGAGAGAGACGGCTGA[C/T]
GCGATGGCGAGCTCGGCGGTGGAGAGGAGCGGCAGGAGAGGATGCGCCGGCGGTAGCAGCTGGTGCCGGTCGGAGGGGGGAGATGAGACCCGCAGGAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 3.90% 0.89% 3.53% NA
All Indica  2759 93.80% 0.20% 0.22% 5.80% NA
All Japonica  1512 85.80% 11.80% 2.05% 0.40% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.00% 0.00% 2.18% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 90.70% 0.00% 0.44% 8.87% NA
Indica Intermediate  786 91.50% 0.00% 0.13% 8.40% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 60.10% 34.50% 4.17% 1.19% NA
Japonica Intermediate  241 95.40% 1.70% 2.90% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 93.30% 2.20% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719006525 G -> DEL N N silent_mutation Average:87.885; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0719006525 G -> A LOC_Os07g31940.1 downstream_gene_variant ; 4197.0bp to feature; MODIFIER silent_mutation Average:87.885; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0719006525 G -> A LOC_Os07g31960.1 downstream_gene_variant ; 1197.0bp to feature; MODIFIER silent_mutation Average:87.885; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0719006525 G -> A LOC_Os07g31950.1 intron_variant ; MODIFIER silent_mutation Average:87.885; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0719006525 G A -0.02 -0.03 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719006525 4.72E-18 7.56E-20 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.41E-14 4.26E-18 mr1082 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.03E-19 5.44E-22 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 2.06E-12 2.07E-12 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.61E-10 1.65E-10 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 3.80E-11 9.51E-12 mr1103 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.86E-12 5.38E-08 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 3.67E-09 3.00E-10 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 2.51E-08 3.54E-06 mr1139 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 5.23E-08 5.23E-08 mr1145 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 4.12E-09 6.31E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 5.24E-13 5.24E-13 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 5.93E-06 NA mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 2.13E-22 7.63E-24 mr1226 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 NA 5.71E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 6.38E-07 1.24E-06 mr1233 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.90E-11 3.65E-13 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 2.78E-16 1.96E-14 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 2.62E-11 2.62E-11 mr1436 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 4.48E-09 1.10E-07 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 3.98E-12 4.74E-13 mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 9.93E-08 NA mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 4.93E-09 4.42E-09 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 8.31E-13 2.99E-14 mr1949 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 4.38E-15 3.92E-12 mr1070_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 4.78E-26 4.79E-26 mr1076_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 8.71E-21 2.59E-28 mr1082_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 4.43E-26 2.68E-34 mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.04E-15 4.31E-15 mr1085_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.69E-06 NA mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 3.11E-21 5.97E-22 mr1103_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 8.40E-24 1.61E-22 mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 2.01E-21 2.58E-22 mr1107_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.66E-16 1.67E-16 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 8.47E-17 2.18E-11 mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 4.23E-29 8.14E-34 mr1226_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 4.30E-09 4.31E-09 mr1233_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 3.11E-08 3.12E-08 mr1264_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 7.79E-19 4.49E-24 mr1408_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.53E-13 1.84E-11 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 2.69E-08 NA mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 1.35E-08 1.35E-08 mr1878_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719006525 3.84E-11 1.28E-10 mr1949_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251