\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719005656:

Variant ID: vg0719005656 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19005656
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTTAATCAGAGGCCGGAGATGAAGCTTCGGAGGATCCCTATGCCTATTACCAGGAGGGTGATGAAGACGATGGCGCTCAGTAGGTCTTAATTACGGT[C/A]
GTTGCCTGTGGCAATGGCGTGCCGCTGCCTTAACTCCACTGCCTTACCTACTTCTGTTTTTTGAATGTATTCCGGACCGCTCGGTCTGATGATTTAAGAC

Reverse complement sequence

GTCTTAAATCATCAGACCGAGCGGTCCGGAATACATTCAAAAAACAGAAGTAGGTAAGGCAGTGGAGTTAAGGCAGCGGCACGCCATTGCCACAGGCAAC[G/T]
ACCGTAATTAAGACCTACTGAGCGCCATCGTCTTCATCACCCTCCTGGTAATAGGCATAGGGATCCTCCGAAGCTTCATCTCCGGCCTCTGATTAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 46.90% 1.31% 1.69% NA
All Indica  2759 16.30% 78.80% 2.14% 2.68% NA
All Japonica  1512 99.00% 0.60% 0.07% 0.33% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 8.90% 89.40% 0.50% 1.18% NA
Indica II  465 11.00% 88.80% 0.22% 0.00% NA
Indica III  913 19.90% 73.50% 2.63% 3.94% NA
Indica Intermediate  786 21.00% 71.10% 3.94% 3.94% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 0.40% 0.20% 0.99% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 66.70% 30.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719005656 C -> DEL N N silent_mutation Average:35.41; most accessible tissue: Minghui63 flower, score: 54.496 N N N N
vg0719005656 C -> A LOC_Os07g31950.1 upstream_gene_variant ; 461.0bp to feature; MODIFIER silent_mutation Average:35.41; most accessible tissue: Minghui63 flower, score: 54.496 N N N N
vg0719005656 C -> A LOC_Os07g31940.1 downstream_gene_variant ; 3328.0bp to feature; MODIFIER silent_mutation Average:35.41; most accessible tissue: Minghui63 flower, score: 54.496 N N N N
vg0719005656 C -> A LOC_Os07g31960.1 downstream_gene_variant ; 2066.0bp to feature; MODIFIER silent_mutation Average:35.41; most accessible tissue: Minghui63 flower, score: 54.496 N N N N
vg0719005656 C -> A LOC_Os07g31940-LOC_Os07g31950 intergenic_region ; MODIFIER silent_mutation Average:35.41; most accessible tissue: Minghui63 flower, score: 54.496 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719005656 NA 4.40E-08 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 1.65E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 2.65E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 1.95E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 2.22E-20 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 9.15E-08 mr1131 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 5.33E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 2.10E-08 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 2.27E-12 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 8.39E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 5.08E-07 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 1.27E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 3.53E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 2.92E-08 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 9.87E-06 NA mr1104_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 6.99E-06 NA mr1107_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 1.29E-06 4.23E-12 mr1155_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 3.14E-06 mr1224_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 2.82E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 NA 6.45E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 4.82E-06 3.95E-09 mr1404_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719005656 7.11E-06 3.48E-08 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251