Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0718996417:

Variant ID: vg0718996417 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18996417
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCCTACTTATTATTTCACCTTCATGGTTGACCTACTACGCAAACGCTGATGATCGTCTTCATCATTATCATCGGCTGCTACACCGCTATTGACTGGAT[C/T]
GCCGACATCGTCATCTTCATCAACATCCTGTCAAGCCTCTTCAACATAGCCTAATCTACTGCTATCGATGGGCAACTTCGTCATCATAGTCGATCATGTC

Reverse complement sequence

GACATGATCGACTATGATGACGAAGTTGCCCATCGATAGCAGTAGATTAGGCTATGTTGAAGAGGCTTGACAGGATGTTGATGAAGATGACGATGTCGGC[G/A]
ATCCAGTCAATAGCGGTGTAGCAGCCGATGATAATGATGAAGACGATCATCAGCGTTTGCGTAGTAGGTCAACCATGAAGGTGAAATAATAAGTAGGCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.20%	11.30%	0.49%	0.00%	NA
All Indica	2759	97.30%	1.90%	0.80%	0.00%	NA
All Japonica	1512	70.20%	29.80%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	99.20%	0.00%	0.84%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	95.70%	3.30%	0.99%	0.00%	NA
Indica Intermediate	786	97.50%	1.50%	1.02%	0.00%	NA
Temperate Japonica	767	97.10%	2.90%	0.00%	0.00%	NA
Tropical Japonica	504	32.90%	67.10%	0.00%	0.00%	NA
Japonica Intermediate	241	62.20%	37.80%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718996417	C -> T	LOC_Os07g31930.1	intron_variant ; MODIFIER	silent_mutation	Average:24.852; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718996417	NA	4.92E-12	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718996417	NA	4.16E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	9.04E-06	9.04E-06	mr1212	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	1.35E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	1.42E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	9.30E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	3.28E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	2.69E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	7.20E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	1.13E-20	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	1.98E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	7.99E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	4.33E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	1.55E-09	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	1.65E-13	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	6.51E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	2.44E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	6.16E-07	NA	mr1083_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	2.91E-24	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	3.37E-09	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	1.75E-06	5.45E-12	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	4.32E-16	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	3.90E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	4.27E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	6.59E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718996417	NA	1.79E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251