\
| Variant ID: vg0718985292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18985292 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 89. )
CCTAGAAACCCTTGAAAAGCTGTTAATTACTAACTCCATCCCCAAAAAGTTATCTTCCTAACATTTAAAATTTATCCCATGATATTTATCACTCGAAGTA[T/C]
TACTTGTCCCAGTCCAATCCATCATCTTCCATTTAAATTTCTCCGTATTATACCTTTCAACTATCACTTCACTTTTAACCATACATCATTTAATGAAGGT
ACCTTCATTAAATGATGTATGGTTAAAAGTGAAGTGATAGTTGAAAGGTATAATACGGAGAAATTTAAATGGAAGATGATGGATTGGACTGGGACAAGTA[A/G]
TACTTCGAGTGATAAATATCATGGGATAAATTTTAAATGTTAGGAAGATAACTTTTTGGGGATGGAGTTAGTAATTAACAGCTTTTCAAGGGTTTCTAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 23.40% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 62.40% | 37.30% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 21.80% | 77.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 76.10% | 23.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.10% | 17.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 62.00% | 37.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718985292 | T -> C | LOC_Os07g31920.1 | upstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:45.824; most accessible tissue: Callus, score: 83.06 | N | N | N | N |
| vg0718985292 | T -> C | LOC_Os07g31920-LOC_Os07g31930 | intergenic_region ; MODIFIER | silent_mutation | Average:45.824; most accessible tissue: Callus, score: 83.06 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718985292 | NA | 7.98E-07 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 2.48E-07 | NA | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 3.03E-06 | NA | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 2.53E-06 | NA | mr1620 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 1.88E-06 | NA | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | NA | 4.29E-07 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 5.83E-06 | NA | mr1104_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 6.60E-06 | NA | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 5.89E-08 | NA | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 9.52E-07 | NA | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 2.63E-08 | NA | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 6.37E-06 | NA | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 1.83E-06 | NA | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 6.19E-06 | NA | mr1437_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 7.33E-06 | NA | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718985292 | 1.28E-07 | NA | mr1949_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |