\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718983067:

Variant ID: vg0718983067 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18983067
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AAACATAGCTGCAAATGTAATATGACAAAAAAAACATTGGAGGATGAAGTTGCAAACCTTTTAGGCACCTCCGATTTGTATGTAATCACCAAAATAAATT[C/T]
ACTGGAAATTTTGGTATGACCTCCCCTCTTTTTTGAAGAAATTTTGGAGCTTGCTCGGGCAGCTGGAGGAGGAAGAAGACATATATATAGGGGTGGGACT

Reverse complement sequence

AGTCCCACCCCTATATATATGTCTTCTTCCTCCTCCAGCTGCCCGAGCAAGCTCCAAAATTTCTTCAAAAAAGAGGGGAGGTCATACCAAAATTTCCAGT[G/A]
AATTTATTTTGGTGATTACATACAAATCGGAGGTGCCTAAAAGGTTTGCAACTTCATCCTCCAATGTTTTTTTTGTCATATTACATTTGCAGCTATGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 23.10% 6.01% 15.36% NA
All Indica  2759 78.00% 1.30% 4.13% 16.60% NA
All Japonica  1512 23.10% 67.30% 3.70% 5.82% NA
Aus  269 21.60% 0.40% 30.48% 47.58% NA
Indica I  595 86.40% 0.50% 2.35% 10.76% NA
Indica II  465 86.00% 1.30% 2.58% 10.11% NA
Indica III  913 71.00% 0.40% 5.81% 22.78% NA
Indica Intermediate  786 74.90% 2.90% 4.45% 17.68% NA
Temperate Japonica  767 3.00% 95.40% 1.04% 0.52% NA
Tropical Japonica  504 52.00% 29.20% 7.14% 11.71% NA
Japonica Intermediate  241 27.00% 57.70% 4.98% 10.37% NA
VI/Aromatic  96 9.40% 19.80% 29.17% 41.67% NA
Intermediate  90 60.00% 22.20% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718983067 C -> DEL N N silent_mutation Average:26.681; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0718983067 C -> T LOC_Os07g31910.1 upstream_gene_variant ; 4886.0bp to feature; MODIFIER silent_mutation Average:26.681; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0718983067 C -> T LOC_Os07g31920.1 upstream_gene_variant ; 731.0bp to feature; MODIFIER silent_mutation Average:26.681; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0718983067 C -> T LOC_Os07g31920-LOC_Os07g31930 intergenic_region ; MODIFIER silent_mutation Average:26.681; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718983067 3.53E-06 2.76E-09 mr1155 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 7.65E-10 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 9.50E-07 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 5.07E-07 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 8.51E-08 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 4.16E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 5.41E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 6.57E-06 8.66E-09 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 3.73E-08 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 1.72E-08 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 4.39E-09 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 4.14E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 1.42E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718983067 NA 4.66E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251