\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718641746:

Variant ID: vg0718641746 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18641746
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAGTGCAAAACAGTGAAACACAGTTATTTACAGTAGAAAACAGTAAAACAGAAATTTTGTACTGTAGCAAGGTAGTGTTCATGATGTACTATAGCGTT[T/C,A]
TGTAGCAGTTGATATCGTCTGTTCATTACAGATCAAACGGTTAAAAATAGCCCAAAGGCACAGCACTGTGCGCCTCTACCTTTAGGTCCTTCACAATGCG

Reverse complement sequence

CGCATTGTGAAGGACCTAAAGGTAGAGGCGCACAGTGCTGTGCCTTTGGGCTATTTTTAACCGTTTGATCTGTAATGAACAGACGATATCAACTGCTACA[A/G,T]
AACGCTATAGTACATCATGAACACTACCTTGCTACAGTACAAAATTTCTGTTTTACTGTTTTCTACTGTAAATAACTGTGTTTCACTGTTTTGCACTGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 27.20% 0.00% 0.00% A: 0.17%
All Indica  2759 98.00% 1.70% 0.00% 0.00% A: 0.29%
All Japonica  1512 25.70% 74.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 97.20% 2.00% 0.00% 0.00% A: 0.88%
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 4.40% 95.60% 0.00% 0.00% NA
Tropical Japonica  504 52.40% 47.60% 0.00% 0.00% NA
Japonica Intermediate  241 37.30% 62.70% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718641746 T -> A LOC_Os07g31450.1 upstream_gene_variant ; 3067.0bp to feature; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0718641746 T -> A LOC_Os07g31460.1 upstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0718641746 T -> A LOC_Os07g31460.2 upstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0718641746 T -> A LOC_Os07g31450-LOC_Os07g31460 intergenic_region ; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0718641746 T -> C LOC_Os07g31450.1 upstream_gene_variant ; 3067.0bp to feature; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0718641746 T -> C LOC_Os07g31460.1 upstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0718641746 T -> C LOC_Os07g31460.2 upstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0718641746 T -> C LOC_Os07g31450-LOC_Os07g31460 intergenic_region ; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718641746 NA 1.01E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 1.81E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 3.96E-08 2.07E-36 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 6.73E-07 1.13E-12 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 3.06E-08 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 3.51E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 1.59E-06 2.00E-08 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 1.24E-08 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 3.96E-10 1.75E-14 mr1410 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 1.79E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 1.20E-49 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 2.46E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 2.16E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 7.97E-35 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 1.09E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 2.04E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 9.85E-38 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 8.52E-08 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 3.48E-09 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 2.55E-07 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 1.15E-50 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 2.22E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 1.07E-11 4.46E-14 mr1410_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 2.27E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 2.11E-46 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746 NA 1.12E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251