Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718641746:

Variant ID: vg0718641746 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18641746
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TGCAGTGCAAAACAGTGAAACACAGTTATTTACAGTAGAAAACAGTAAAACAGAAATTTTGTACTGTAGCAAGGTAGTGTTCATGATGTACTATAGCGTT[T/C,A]
TGTAGCAGTTGATATCGTCTGTTCATTACAGATCAAACGGTTAAAAATAGCCCAAAGGCACAGCACTGTGCGCCTCTACCTTTAGGTCCTTCACAATGCG

Reverse complement sequence

CGCATTGTGAAGGACCTAAAGGTAGAGGCGCACAGTGCTGTGCCTTTGGGCTATTTTTAACCGTTTGATCTGTAATGAACAGACGATATCAACTGCTACA[A/G,T]
AACGCTATAGTACATCATGAACACTACCTTGCTACAGTACAAAATTTCTGTTTTACTGTTTTCTACTGTAAATAACTGTGTTTCACTGTTTTGCACTGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	27.20%	0.00%	0.00%	A: 0.17%
All Indica	2759	98.00%	1.70%	0.00%	0.00%	A: 0.29%
All Japonica	1512	25.70%	74.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	97.20%	2.00%	0.00%	0.00%	A: 0.88%
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	4.40%	95.60%	0.00%	0.00%	NA
Tropical Japonica	504	52.40%	47.60%	0.00%	0.00%	NA
Japonica Intermediate	241	37.30%	62.70%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718641746	T -> A	LOC_Os07g31450.1	upstream_gene_variant ; 3067.0bp to feature; MODIFIER	silent_mutation	Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0718641746	T -> A	LOC_Os07g31460.1	upstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0718641746	T -> A	LOC_Os07g31460.2	upstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0718641746	T -> A	LOC_Os07g31450-LOC_Os07g31460	intergenic_region ; MODIFIER	silent_mutation	Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0718641746	T -> C	LOC_Os07g31450.1	upstream_gene_variant ; 3067.0bp to feature; MODIFIER	silent_mutation	Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0718641746	T -> C	LOC_Os07g31460.1	upstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0718641746	T -> C	LOC_Os07g31460.2	upstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0718641746	T -> C	LOC_Os07g31450-LOC_Os07g31460	intergenic_region ; MODIFIER	silent_mutation	Average:71.25; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718641746	NA	1.01E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	1.81E-21	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	3.96E-08	2.07E-36	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	6.73E-07	1.13E-12	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	3.06E-08	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	3.51E-07	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	1.59E-06	2.00E-08	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	1.24E-08	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	3.96E-10	1.75E-14	mr1410	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	1.79E-12	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	1.20E-49	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	2.46E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	2.16E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	7.97E-35	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	1.09E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	2.04E-06	mr1088_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	9.85E-38	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	8.52E-08	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	3.48E-09	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	2.55E-07	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	1.15E-50	mr1404_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	2.22E-07	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	1.07E-11	4.46E-14	mr1410_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	2.27E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	2.11E-46	mr1620_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718641746	NA	1.12E-06	mr1620_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251