\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718523777:

Variant ID: vg0718523777 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18523777
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGTTTAGTTGGGGAAAAAAAATTTTGGTTTGGTTGTCACATCAGATATACGGACACACATTTGAAGTATTAAACGTAGTCTAATAACAAAACAAATTA[C/A]
TGTAGAATTCAGGAAACTACGAGACGAATTTATTAAGCCTAATTAATCCGTTGTTAGCAAATGTTTAGTGTAGCACCATATTATCAAATCATGACGCAAT

Reverse complement sequence

ATTGCGTCATGATTTGATAATATGGTGCTACACTAAACATTTGCTAACAACGGATTAATTAGGCTTAATAAATTCGTCTCGTAGTTTCCTGAATTCTACA[G/T]
TAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTGTGTCCGTATATCTGATGTGACAACCAAACCAAAATTTTTTTTCCCCAACTAAACAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 48.20% 0.04% 0.00% NA
All Indica  2759 77.30% 22.70% 0.07% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 81.70% 18.10% 0.22% 0.00% NA
Indica III  913 57.20% 42.70% 0.11% 0.00% NA
Indica Intermediate  786 85.20% 14.80% 0.00% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 35.60% 64.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718523777 C -> A LOC_Os07g31290.1 upstream_gene_variant ; 4731.0bp to feature; MODIFIER silent_mutation Average:84.995; most accessible tissue: Zhenshan97 flower, score: 91.353 N N N N
vg0718523777 C -> A LOC_Os07g31280.1 downstream_gene_variant ; 158.0bp to feature; MODIFIER silent_mutation Average:84.995; most accessible tissue: Zhenshan97 flower, score: 91.353 N N N N
vg0718523777 C -> A LOC_Os07g31280.2 downstream_gene_variant ; 158.0bp to feature; MODIFIER silent_mutation Average:84.995; most accessible tissue: Zhenshan97 flower, score: 91.353 N N N N
vg0718523777 C -> A LOC_Os07g31280.3 downstream_gene_variant ; 158.0bp to feature; MODIFIER silent_mutation Average:84.995; most accessible tissue: Zhenshan97 flower, score: 91.353 N N N N
vg0718523777 C -> A LOC_Os07g31280-LOC_Os07g31290 intergenic_region ; MODIFIER silent_mutation Average:84.995; most accessible tissue: Zhenshan97 flower, score: 91.353 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0718523777 C A -0.01 0.04 0.02 0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718523777 NA 4.68E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 4.81E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 7.31E-07 4.39E-08 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 3.01E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 9.86E-06 1.06E-09 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 NA 3.38E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 NA 8.76E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 2.25E-07 3.62E-09 mr1301 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 6.89E-07 6.83E-10 mr1410 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 NA 4.94E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 NA 2.44E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 NA 5.45E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 NA 8.20E-23 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718523777 NA 8.23E-15 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251