Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718478602:

Variant ID: vg0718478602 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18478602
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTAGTACGCTTGTGAGTAACTATAATCAATTTGGGGGTTCCATCCTCCAAACCGTTACCCTCCAAGTATTATCTTTTGATTCAGGAGTCCAGCAGATTC[A/C]
GGTTCCACTGCTCTGTTTCTGTGATGATCAATCAGATTTTGCACCTCCCTTTGCGTATTTTTCCTTCATCTTGATGTCCAGTGCTGTTTCGGGACCGTTC

Reverse complement sequence

GAACGGTCCCGAAACAGCACTGGACATCAAGATGAAGGAAAAATACGCAAAGGGAGGTGCAAAATCTGATTGATCATCACAGAAACAGAGCAGTGGAACC[T/G]
GAATCTGCTGGACTCCTGAATCAAAAGATAATACTTGGAGGGTAACGGTTTGGAGGATGGAACCCCCAAATTGATTATAGTTACTCACAAGCGTACTAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	2.20%	5.46%	2.03%	NA
All Indica	2759	98.30%	0.10%	0.18%	1.41%	NA
All Japonica	1512	74.10%	6.30%	15.87%	3.70%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.50%	0.90%	0.43%	3.23%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	0.00%	0.38%	3.05%	NA
Temperate Japonica	767	91.10%	1.00%	2.09%	5.74%	NA
Tropical Japonica	504	50.80%	13.70%	34.92%	0.60%	NA
Japonica Intermediate	241	68.50%	7.90%	19.92%	3.73%	NA
VI/Aromatic	96	94.80%	2.10%	3.12%	0.00%	NA
Intermediate	90	85.60%	2.20%	11.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718478602	A -> DEL	N	N	silent_mutation	Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg0718478602	A -> C	LOC_Os07g31210.1	upstream_gene_variant ; 441.0bp to feature; MODIFIER	silent_mutation	Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg0718478602	A -> C	LOC_Os07g31200.1	downstream_gene_variant ; 2285.0bp to feature; MODIFIER	silent_mutation	Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg0718478602	A -> C	LOC_Os07g31220.1	downstream_gene_variant ; 3298.0bp to feature; MODIFIER	silent_mutation	Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg0718478602	A -> C	LOC_Os07g31200-LOC_Os07g31210	intergenic_region ; MODIFIER	silent_mutation	Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718478602	NA	9.15E-12	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718478602	NA	1.15E-08	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	1.27E-08	9.01E-29	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	1.89E-07	8.49E-21	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	NA	1.01E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	NA	2.56E-08	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	NA	6.11E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	NA	6.12E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	NA	1.44E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	1.59E-12	6.42E-34	mr1301_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	2.05E-06	4.76E-17	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	5.94E-08	3.17E-22	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	NA	1.98E-13	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	NA	3.65E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	NA	1.66E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	2.91E-07	2.24E-15	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602	1.35E-06	7.39E-14	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251