\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718478602:

Variant ID: vg0718478602 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18478602
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTAGTACGCTTGTGAGTAACTATAATCAATTTGGGGGTTCCATCCTCCAAACCGTTACCCTCCAAGTATTATCTTTTGATTCAGGAGTCCAGCAGATTC[A/C]
GGTTCCACTGCTCTGTTTCTGTGATGATCAATCAGATTTTGCACCTCCCTTTGCGTATTTTTCCTTCATCTTGATGTCCAGTGCTGTTTCGGGACCGTTC

Reverse complement sequence

GAACGGTCCCGAAACAGCACTGGACATCAAGATGAAGGAAAAATACGCAAAGGGAGGTGCAAAATCTGATTGATCATCACAGAAACAGAGCAGTGGAACC[T/G]
GAATCTGCTGGACTCCTGAATCAAAAGATAATACTTGGAGGGTAACGGTTTGGAGGATGGAACCCCCAAATTGATTATAGTTACTCACAAGCGTACTAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 2.20% 5.46% 2.03% NA
All Indica  2759 98.30% 0.10% 0.18% 1.41% NA
All Japonica  1512 74.10% 6.30% 15.87% 3.70% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.50% 0.90% 0.43% 3.23% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 0.00% 0.38% 3.05% NA
Temperate Japonica  767 91.10% 1.00% 2.09% 5.74% NA
Tropical Japonica  504 50.80% 13.70% 34.92% 0.60% NA
Japonica Intermediate  241 68.50% 7.90% 19.92% 3.73% NA
VI/Aromatic  96 94.80% 2.10% 3.12% 0.00% NA
Intermediate  90 85.60% 2.20% 11.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718478602 A -> DEL N N silent_mutation Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg0718478602 A -> C LOC_Os07g31210.1 upstream_gene_variant ; 441.0bp to feature; MODIFIER silent_mutation Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg0718478602 A -> C LOC_Os07g31200.1 downstream_gene_variant ; 2285.0bp to feature; MODIFIER silent_mutation Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg0718478602 A -> C LOC_Os07g31220.1 downstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg0718478602 A -> C LOC_Os07g31200-LOC_Os07g31210 intergenic_region ; MODIFIER silent_mutation Average:47.989; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718478602 NA 9.15E-12 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718478602 NA 1.15E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 1.27E-08 9.01E-29 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 1.89E-07 8.49E-21 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 NA 1.01E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 NA 2.56E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 NA 6.11E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 NA 6.12E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 NA 1.44E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 1.59E-12 6.42E-34 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 2.05E-06 4.76E-17 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 5.94E-08 3.17E-22 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 NA 1.98E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 NA 3.65E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 NA 1.66E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 2.91E-07 2.24E-15 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718478602 1.35E-06 7.39E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251