\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718376392:

Variant ID: vg0718376392 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18376392
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATCCGTGACGGGTTTAAGTTAAAGCCCGTCACCGATGAGTATTTCCTCCCAAAAAATAAATTCTGTTTTTTCGCTAGCCTCAGGCCTTTACTAGCCAT[G/A]
CCCGTTGTAAAATGAAGAAACAAATATATTTCACAATATCCCAGCATCCCCAATCATATACAATCATTCACATACACATATGCTATTCACATATTTCATA

Reverse complement sequence

TATGAAATATGTGAATAGCATATGTGTATGTGAATGATTGTATATGATTGGGGATGCTGGGATATTGTGAAATATATTTGTTTCTTCATTTTACAACGGG[C/T]
ATGGCTAGTAAAGGCCTGAGGCTAGCGAAAAAACAGAATTTATTTTTTGGGAGGAAATACTCATCGGTGACGGGCTTTAACTTAAACCCGTCACGGATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.50% 18.60% 22.26% 32.63% NA
All Indica  2759 24.20% 11.60% 31.93% 32.22% NA
All Japonica  1512 30.30% 33.80% 5.36% 30.56% NA
Aus  269 3.30% 10.40% 27.51% 58.74% NA
Indica I  595 18.00% 6.40% 11.60% 64.03% NA
Indica II  465 10.80% 10.80% 42.58% 35.91% NA
Indica III  913 29.50% 15.30% 38.12% 17.09% NA
Indica Intermediate  786 30.90% 11.70% 33.84% 23.54% NA
Temperate Japonica  767 22.00% 50.20% 8.21% 19.56% NA
Tropical Japonica  504 37.90% 11.30% 2.58% 48.21% NA
Japonica Intermediate  241 40.70% 28.60% 2.07% 28.63% NA
VI/Aromatic  96 88.50% 0.00% 2.08% 9.38% NA
Intermediate  90 35.60% 22.20% 15.56% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718376392 G -> DEL N N silent_mutation Average:15.784; most accessible tissue: Callus, score: 39.772 N N N N
vg0718376392 G -> A LOC_Os07g31040.1 upstream_gene_variant ; 3862.0bp to feature; MODIFIER silent_mutation Average:15.784; most accessible tissue: Callus, score: 39.772 N N N N
vg0718376392 G -> A LOC_Os07g31020.1 downstream_gene_variant ; 3652.0bp to feature; MODIFIER silent_mutation Average:15.784; most accessible tissue: Callus, score: 39.772 N N N N
vg0718376392 G -> A LOC_Os07g31030.1 downstream_gene_variant ; 665.0bp to feature; MODIFIER silent_mutation Average:15.784; most accessible tissue: Callus, score: 39.772 N N N N
vg0718376392 G -> A LOC_Os07g31030-LOC_Os07g31040 intergenic_region ; MODIFIER silent_mutation Average:15.784; most accessible tissue: Callus, score: 39.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718376392 NA 5.47E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718376392 NA 2.51E-11 mr1399_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718376392 NA 3.76E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251