Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0718144985:

Variant ID: vg0718144985 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18144985
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TAACATGTTAGATTTGTCTTTCATGTTAAGATCTTATCGCATTTAAGTATATTAGATTTCTGTTTAGTATATTCTATTTGCTTTAATATCTTAATATAAA[G/A]
TAGTATCGGAGTATTAGCTGATACATGCTAGATCTATTTGATCGGTTATGCTATGAATATGTATATAATCTCATTATTAATATATATTTCGATCTAAGTG

Reverse complement sequence

CACTTAGATCGAAATATATATTAATAATGAGATTATATACATATTCATAGCATAACCGATCAAATAGATCTAGCATGTATCAGCTAATACTCCGATACTA[C/T]
TTTATATTAAGATATTAAAGCAAATAGAATATACTAAACAGAAATCTAATATACTTAAATGCGATAAGATCTTAACATGAAAGACAAATCTAACATGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.10%	28.50%	0.40%	0.00%	NA
All Indica	2759	54.00%	45.40%	0.65%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	69.50%	30.50%	0.00%	0.00%	NA
Indica I	595	29.20%	69.10%	1.68%	0.00%	NA
Indica II	465	78.30%	21.10%	0.65%	0.00%	NA
Indica III	913	48.70%	51.20%	0.11%	0.00%	NA
Indica Intermediate	786	64.40%	35.10%	0.51%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718144985	G -> A	LOC_Os07g30660.1	upstream_gene_variant ; 1317.0bp to feature; MODIFIER	silent_mutation	Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0718144985	G -> A	LOC_Os07g30670.1	upstream_gene_variant ; 4096.0bp to feature; MODIFIER	silent_mutation	Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0718144985	G -> A	LOC_Os07g30670.2	upstream_gene_variant ; 4100.0bp to feature; MODIFIER	silent_mutation	Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0718144985	G -> A	LOC_Os07g30670.3	upstream_gene_variant ; 4100.0bp to feature; MODIFIER	silent_mutation	Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0718144985	G -> A	LOC_Os07g30650.1	downstream_gene_variant ; 4861.0bp to feature; MODIFIER	silent_mutation	Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0718144985	G -> A	LOC_Os07g30660-LOC_Os07g30670	intergenic_region ; MODIFIER	silent_mutation	Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718144985	2.74E-06	3.19E-07	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985	NA	4.17E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985	1.09E-06	NA	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985	5.99E-08	5.08E-09	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985	NA	6.00E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985	7.40E-07	NA	mr1968_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985	5.43E-07	4.34E-12	mr1968_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251