\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718144985:

Variant ID: vg0718144985 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18144985
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TAACATGTTAGATTTGTCTTTCATGTTAAGATCTTATCGCATTTAAGTATATTAGATTTCTGTTTAGTATATTCTATTTGCTTTAATATCTTAATATAAA[G/A]
TAGTATCGGAGTATTAGCTGATACATGCTAGATCTATTTGATCGGTTATGCTATGAATATGTATATAATCTCATTATTAATATATATTTCGATCTAAGTG

Reverse complement sequence

CACTTAGATCGAAATATATATTAATAATGAGATTATATACATATTCATAGCATAACCGATCAAATAGATCTAGCATGTATCAGCTAATACTCCGATACTA[C/T]
TTTATATTAAGATATTAAAGCAAATAGAATATACTAAACAGAAATCTAATATACTTAAATGCGATAAGATCTTAACATGAAAGACAAATCTAACATGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 28.50% 0.40% 0.00% NA
All Indica  2759 54.00% 45.40% 0.65% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 69.50% 30.50% 0.00% 0.00% NA
Indica I  595 29.20% 69.10% 1.68% 0.00% NA
Indica II  465 78.30% 21.10% 0.65% 0.00% NA
Indica III  913 48.70% 51.20% 0.11% 0.00% NA
Indica Intermediate  786 64.40% 35.10% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718144985 G -> A LOC_Os07g30660.1 upstream_gene_variant ; 1317.0bp to feature; MODIFIER silent_mutation Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0718144985 G -> A LOC_Os07g30670.1 upstream_gene_variant ; 4096.0bp to feature; MODIFIER silent_mutation Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0718144985 G -> A LOC_Os07g30670.2 upstream_gene_variant ; 4100.0bp to feature; MODIFIER silent_mutation Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0718144985 G -> A LOC_Os07g30670.3 upstream_gene_variant ; 4100.0bp to feature; MODIFIER silent_mutation Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0718144985 G -> A LOC_Os07g30650.1 downstream_gene_variant ; 4861.0bp to feature; MODIFIER silent_mutation Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0718144985 G -> A LOC_Os07g30660-LOC_Os07g30670 intergenic_region ; MODIFIER silent_mutation Average:31.162; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718144985 2.74E-06 3.19E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985 NA 4.17E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985 1.09E-06 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985 5.99E-08 5.08E-09 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985 NA 6.00E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985 7.40E-07 NA mr1968_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718144985 5.43E-07 4.34E-12 mr1968_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251