\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718112109:

Variant ID: vg0718112109 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 18112109
Reference Allele: AAlternative Allele: G,ATG
Primary Allele: ASecondary Allele: ATG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCGAGCGGTGCGCGGTGGCGCTTGCACGACGAGAGCCAACAGCGACGACAGGCAGTGAGGGCGGCGGATCTAGCGCCCCTGTCCTCGGGAGCAGCTGC[A/G,ATG]
GCGGGCGGCAGATCCGGCTCTCCCGATGGCGGCGTTGCCGGATCCACCGCCCTCAGAATGCCTGCGATGGGCAACAACGACGGGCTCGAGCGATGGTAGG

Reverse complement sequence

CCTACCATCGCTCGAGCCCGTCGTTGTTGCCCATCGCAGGCATTCTGAGGGCGGTGGATCCGGCAACGCCGCCATCGGGAGAGCCGGATCTGCCGCCCGC[T/C,CAT]
GCAGCTGCTCCCGAGGACAGGGGCGCTAGATCCGCCGCCCTCACTGCCTGTCGTCGCTGTTGGCTCTCGTCGTGCAAGCGCCACCGCGCACCGCTCGGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of ATG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.50% 28.90% 0.25% 0.13% G: 23.19%
All Indica  2759 28.50% 46.10% 0.29% 0.22% G: 24.90%
All Japonica  1512 86.60% 0.00% 0.13% 0.00% G: 13.29%
Aus  269 3.00% 29.70% 0.37% 0.00% G: 66.91%
Indica I  595 24.70% 71.30% 0.17% 0.00% G: 3.87%
Indica II  465 15.90% 20.60% 0.43% 0.65% G: 62.37%
Indica III  913 31.70% 51.70% 0.11% 0.11% G: 16.43%
Indica Intermediate  786 35.20% 35.50% 0.51% 0.25% G: 28.50%
Temperate Japonica  767 98.20% 0.00% 0.26% 0.00% G: 1.56%
Tropical Japonica  504 69.40% 0.00% 0.00% 0.00% G: 30.56%
Japonica Intermediate  241 85.50% 0.00% 0.00% 0.00% G: 14.52%
VI/Aromatic  96 90.60% 1.00% 1.04% 0.00% G: 7.29%
Intermediate  90 61.10% 15.60% 0.00% 0.00% G: 23.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718112109 A -> DEL N N silent_mutation Average:79.057; most accessible tissue: Zhenshan97 young leaf, score: 91.967 N N N N
vg0718112109 A -> G LOC_Os07g30600.1 downstream_gene_variant ; 858.0bp to feature; MODIFIER silent_mutation Average:79.057; most accessible tissue: Zhenshan97 young leaf, score: 91.967 N N N N
vg0718112109 A -> G LOC_Os07g30610.1 downstream_gene_variant ; 1363.0bp to feature; MODIFIER silent_mutation Average:79.057; most accessible tissue: Zhenshan97 young leaf, score: 91.967 N N N N
vg0718112109 A -> G LOC_Os07g30600-LOC_Os07g30610 intergenic_region ; MODIFIER silent_mutation Average:79.057; most accessible tissue: Zhenshan97 young leaf, score: 91.967 N N N N
vg0718112109 A -> ATG LOC_Os07g30600.1 downstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:79.057; most accessible tissue: Zhenshan97 young leaf, score: 91.967 N N N N
vg0718112109 A -> ATG LOC_Os07g30610.1 downstream_gene_variant ; 1362.0bp to feature; MODIFIER silent_mutation Average:79.057; most accessible tissue: Zhenshan97 young leaf, score: 91.967 N N N N
vg0718112109 A -> ATG LOC_Os07g30600-LOC_Os07g30610 intergenic_region ; MODIFIER silent_mutation Average:79.057; most accessible tissue: Zhenshan97 young leaf, score: 91.967 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0718112109 A ATG -0.08 -0.18 -0.19 -0.09 -0.13 -0.18
vg0718112109 A G -0.01 0.0 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718112109 NA 9.54E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 3.49E-06 NA mr1480 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 5.77E-06 2.18E-07 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 NA 9.90E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 NA 1.29E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 NA 3.55E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 NA 2.83E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 1.27E-07 NA mr1692 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 NA 8.49E-08 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 NA 4.48E-06 mr1692 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 6.51E-06 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 2.16E-06 3.89E-09 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 NA 1.13E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718112109 NA 5.75E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251