\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718107292:

Variant ID: vg0718107292 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18107292
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGAGAATTTTTTTTAAATAAAGTTTGTGAATAGAGATACATACGTCTAAAAGTCTAGCGCATATGGGATCTATGTGAGGTCCAACCGTTTGCATGAC[G/A]
CGTACAACGCGCGGTCGCACGTCTCTATGAAAGTACTTTGGAGAACAGGGTTTGTCTCCTTTTATAGCGTATTCTAACTTTTGACTTGGGATTTAGCCTC

Reverse complement sequence

GAGGCTAAATCCCAAGTCAAAAGTTAGAATACGCTATAAAAGGAGACAAACCCTGTTCTCCAAAGTACTTTCATAGAGACGTGCGACCGCGCGTTGTACG[C/T]
GTCATGCAAACGGTTGGACCTCACATAGATCCCATATGCGCTAGACTTTTAGACGTATGTATCTCTATTCACAAACTTTATTTAAAAAAAATTCTCTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.10% 0.13% 0.36% NA
All Indica  2759 51.60% 47.60% 0.18% 0.54% NA
All Japonica  1512 87.20% 12.70% 0.07% 0.00% NA
Aus  269 70.60% 29.00% 0.00% 0.37% NA
Indica I  595 25.00% 74.10% 0.17% 0.67% NA
Indica II  465 76.60% 22.40% 0.43% 0.65% NA
Indica III  913 47.40% 52.20% 0.11% 0.22% NA
Indica Intermediate  786 62.00% 37.20% 0.13% 0.76% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 68.50% 31.30% 0.20% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718107292 G -> DEL N N silent_mutation Average:44.405; most accessible tissue: Callus, score: 79.831 N N N N
vg0718107292 G -> A LOC_Os07g30590.1 upstream_gene_variant ; 3577.0bp to feature; MODIFIER silent_mutation Average:44.405; most accessible tissue: Callus, score: 79.831 N N N N
vg0718107292 G -> A LOC_Os07g30600.1 intron_variant ; MODIFIER silent_mutation Average:44.405; most accessible tissue: Callus, score: 79.831 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718107292 2.97E-07 NA mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292 5.41E-07 1.20E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292 NA 8.53E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292 NA 9.24E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292 5.46E-06 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292 8.08E-09 5.92E-09 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292 NA 5.33E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292 1.99E-07 5.77E-11 mr1968_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251