| Variant ID: vg0718004907 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18004907 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, C: 0.07, others allele: 0.00, population size: 163. )
CACGGCCCATCAAGAGTTCACGGACTATATTTTCAGTTGTGTTCTGTCATGTACCTTTAGGGATTAAGCATTTTTGCTCTTGGCAATACATGCGTGCTCA[A/C]
GTGTCTAATATATACCTTAAATCTTTTTATATATCTGATACACAACTTTTCAGTAGTTGGCACAATACAATTTAAAAGGTGGCAAAAGTAAAGCTTTACG
CGTAAAGCTTTACTTTTGCCACCTTTTAAATTGTATTGTGCCAACTACTGAAAAGTTGTGTATCAGATATATAAAAAGATTTAAGGTATATATTAGACAC[T/G]
TGAGCACGCATGTATTGCCAAGAGCAAAAATGCTTAATCCCTAAAGGTACATGACAGAACACAACTGAAAATATAGTCCGTGAACTCTTGATGGGCCGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.90% | 37.80% | 1.14% | 19.15% | NA |
| All Indica | 2759 | 15.10% | 60.70% | 1.67% | 22.54% | NA |
| All Japonica | 1512 | 82.90% | 0.90% | 0.40% | 15.81% | NA |
| Aus | 269 | 72.50% | 27.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 31.30% | 56.00% | 1.85% | 10.92% | NA |
| Indica II | 465 | 8.00% | 80.20% | 1.29% | 10.54% | NA |
| Indica III | 913 | 3.10% | 61.10% | 1.53% | 34.28% | NA |
| Indica Intermediate | 786 | 21.10% | 52.20% | 1.91% | 24.81% | NA |
| Temperate Japonica | 767 | 89.70% | 0.80% | 0.39% | 9.13% | NA |
| Tropical Japonica | 504 | 77.60% | 0.40% | 0.60% | 21.43% | NA |
| Japonica Intermediate | 241 | 72.60% | 2.10% | 0.00% | 25.31% | NA |
| VI/Aromatic | 96 | 65.60% | 3.10% | 1.04% | 30.21% | NA |
| Intermediate | 90 | 57.80% | 25.60% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718004907 | A -> DEL | N | N | silent_mutation | Average:29.423; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg0718004907 | A -> C | LOC_Os07g30420.1 | downstream_gene_variant ; 999.0bp to feature; MODIFIER | silent_mutation | Average:29.423; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg0718004907 | A -> C | LOC_Os07g30410-LOC_Os07g30420 | intergenic_region ; MODIFIER | silent_mutation | Average:29.423; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718004907 | NA | 2.79E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718004907 | NA | 1.37E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718004907 | 4.01E-06 | NA | mr1015_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718004907 | 5.42E-06 | 1.80E-10 | mr1047_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718004907 | NA | 4.31E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718004907 | NA | 5.19E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718004907 | NA | 6.98E-07 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718004907 | NA | 3.36E-11 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718004907 | 2.18E-06 | 5.80E-09 | mr1834_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |