\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717854157:

Variant ID: vg0717854157 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17854157
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAAATGGGTATGCTAAAACAACGCCTCCAAGGAGGGGAACGACGCCAAACAGCGTCGTCGTTGTCAGCCGGCCAAATGGCTCAGCAAGGCTTTCGCCC[A/G]
CGATTCCCTGTCCAAACCCACACCACCAATCCGCACAAGAAAGATCGTTGTCGGTCAACAACATTGTCCCTTCAGCGATTCGGCAAAGGCCACAGCCCAC

Reverse complement sequence

GTGGGCTGTGGCCTTTGCCGAATCGCTGAAGGGACAATGTTGTTGACCGACAACGATCTTTCTTGTGCGGATTGGTGGTGTGGGTTTGGACAGGGAATCG[T/C]
GGGCGAAAGCCTTGCTGAGCCATTTGGCCGGCTGACAACGACGACGCTGTTTGGCGTCGTTCCCCTCCTTGGAGGCGTTGTTTTAGCATACCCATTTCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 3.70% 0.08% 5.12% NA
All Indica  2759 93.60% 6.30% 0.00% 0.07% NA
All Japonica  1512 84.20% 0.00% 0.20% 15.61% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.20% 0.00% 0.17% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 89.80% 10.20% 0.00% 0.00% NA
Indica Intermediate  786 90.50% 9.40% 0.00% 0.13% NA
Temperate Japonica  767 72.10% 0.00% 0.26% 27.64% NA
Tropical Japonica  504 96.40% 0.00% 0.20% 3.37% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 95.60% 2.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717854157 A -> DEL LOC_Os07g30220.1 N frameshift_variant Average:82.885; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0717854157 A -> G LOC_Os07g30220.1 missense_variant ; p.Val47Ala; MODERATE nonsynonymous_codon ; V47A Average:82.885; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0717854157 A G 0.04 0.02 0.04 0.03 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717854157 NA 1.30E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 NA 5.91E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 NA 1.62E-09 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 NA 1.90E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 NA 9.64E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 1.79E-06 2.39E-10 mr1155_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 NA 1.49E-07 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 NA 3.30E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 4.37E-07 1.86E-07 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717854157 3.35E-08 2.21E-09 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251