\
| Variant ID: vg0717634270 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17634270 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTCAAGGCCCGGTGATTTTGTCCCGGCCCAGGCATAGCACGGCTCGACTCTGGTCGTGCCTATGTCGGCCCAGCCCAACAGCCATGCTGTGTCTGGGCT[A/G]
CTACTTCGGTACGCTAGGCTGGCAAGGCCAGGCCCAAAGTTTAGGGATACGAAACAGATTTATTCTCAACCATATTTAAGGCACGTCAAAAAAATAGGGA
TCCCTATTTTTTTGACGTGCCTTAAATATGGTTGAGAATAAATCTGTTTCGTATCCCTAAACTTTGGGCCTGGCCTTGCCAGCCTAGCGTACCGAAGTAG[T/C]
AGCCCAGACACAGCATGGCTGTTGGGCTGGGCCGACATAGGCACGACCAGAGTCGAGCCGTGCTATGCCTGGGCCGGGACAAAATCACCGGGCCTTGAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.60% | 16.30% | 3.41% | 37.69% | NA |
| All Indica | 2759 | 40.20% | 1.60% | 2.83% | 55.31% | NA |
| All Japonica | 1512 | 49.90% | 35.30% | 4.56% | 10.19% | NA |
| Aus | 269 | 6.30% | 63.90% | 4.09% | 25.65% | NA |
| Indica I | 595 | 48.90% | 0.50% | 5.21% | 45.38% | NA |
| Indica II | 465 | 19.60% | 1.30% | 2.15% | 76.99% | NA |
| Indica III | 913 | 42.20% | 0.50% | 1.53% | 55.75% | NA |
| Indica Intermediate | 786 | 43.60% | 3.90% | 2.93% | 49.49% | NA |
| Temperate Japonica | 767 | 55.10% | 38.10% | 5.87% | 0.91% | NA |
| Tropical Japonica | 504 | 38.10% | 36.90% | 2.78% | 22.22% | NA |
| Japonica Intermediate | 241 | 58.10% | 23.20% | 4.15% | 14.52% | NA |
| VI/Aromatic | 96 | 91.70% | 2.10% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 50.00% | 17.80% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717634270 | A -> DEL | N | N | silent_mutation | Average:15.519; most accessible tissue: Callus, score: 99.071 | N | N | N | N |
| vg0717634270 | A -> G | LOC_Os07g29950.1 | upstream_gene_variant ; 892.0bp to feature; MODIFIER | silent_mutation | Average:15.519; most accessible tissue: Callus, score: 99.071 | N | N | N | N |
| vg0717634270 | A -> G | LOC_Os07g29940-LOC_Os07g29950 | intergenic_region ; MODIFIER | silent_mutation | Average:15.519; most accessible tissue: Callus, score: 99.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717634270 | NA | 2.71E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 1.83E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 7.15E-08 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 3.50E-08 | mr1358 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 3.60E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 6.93E-08 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 3.07E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 7.08E-09 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 6.35E-08 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 3.52E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717634270 | NA | 3.33E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |