Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0717412492:

Variant ID: vg0717412492 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17412492
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGTTTTCACCATGACTGTAATCACATATAGGGCAGAACCATTAAGATACTTCCAGAAAGAGAGAAAAACAAAACCTTCAAATTGATGTGAATGCCCTC[A/G]
CTGTTCTTGTTCCCCTTGTACACTCGACTTGCAAAGGCAGGAATATAGTGTCCAGCATACGATTCCCCAGTAATATAGAAATCATTTTTAGCAAAATTCG

Reverse complement sequence

CGAATTTTGCTAAAAATGATTTCTATATTACTGGGGAATCGTATGCTGGACACTATATTCCTGCCTTTGCAAGTCGAGTGTACAAGGGGAACAAGAACAG[T/C]
GAGGGCATTCACATCAATTTGAAGGTTTTGTTTTTCTCTCTTTCTGGAAGTATCTTAATGGTTCTGCCCTATATGTGATTACAGTCATGGTGAAAACCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 37.70% 0.36% 0.00% NA
All Indica  2759 97.40% 2.20% 0.43% 0.00% NA
All Japonica  1512 7.30% 92.60% 0.13% 0.00% NA
Aus  269 29.40% 70.60% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 98.80% 0.90% 0.33% 0.00% NA
Indica Intermediate  786 94.90% 4.30% 0.76% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 12.30% 87.30% 0.40% 0.00% NA
Japonica Intermediate  241 15.80% 84.20% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 89.60% 2.08% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717412492 A -> G LOC_Os07g29620.1 synonymous_variant ; p.Ser263Ser; LOW synonymous_codon Average:75.119; most accessible tissue: Zhenshan97 young leaf, score: 85.364 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0717412492 A G -0.02 -0.02 -0.02 -0.02 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717412492 NA 3.68E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 4.44E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 1.21E-25 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 3.58E-24 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 1.53E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 2.02E-57 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 1.09E-34 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 1.12E-40 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 3.37E-28 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 2.41E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 7.68E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 4.94E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 1.96E-42 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 7.49E-31 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 5.53E-49 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 8.21E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 2.16E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 2.92E-22 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 3.65E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 5.05E-40 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 1.28E-31 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 3.63E-24 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 6.89E-58 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 5.24E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 8.63E-44 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 4.35E-33 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 4.73E-65 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 5.40E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 4.59E-85 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 6.28E-34 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 1.83E-25 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 4.70E-07 4.70E-07 mr1877_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 7.89E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 5.67E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 9.84E-63 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717412492 NA 1.86E-97 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251