Variant ID: vg0717368399 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 17368399 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTTTGCCCTTTACGGTATCCATCCCACCTACAATCATCTCCGTGTTTTTGGTTGTAAGTGTTATCCAAACCTCTCCGCCACTGCTCCAGATAAGCTATCA[G/C]
TTCGTTCCACAGCATGCGTCTTTCTTGGCTATCCCAGAGATCACAAAGGGTATCGGTGTATGGACCTTAGTTTTAACCGAGTTATCATCTCGCGTCATAT
ATATGACGCGAGATGATAACTCGGTTAAAACTAAGGTCCATACACCGATACCCTTTGTGATCTCTGGGATAGCCAAGAAAGACGCATGCTGTGGAACGAA[C/G]
TGATAGCTTATCTGGAGCAGTGGCGGAGAGGTTTGGATAACACTTACAACCAAAAACACGGAGATGATTGTAGGTGGGATGGATACCGTAAAGGGCAAAG
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.70% | 8.70% | 1.57% | 0.00% | NA |
All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 69.60% | 26.30% | 4.17% | 0.00% | NA |
Aus | 269 | 96.70% | 0.70% | 2.60% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 47.80% | 46.80% | 5.35% | 0.00% | NA |
Tropical Japonica | 504 | 95.40% | 2.40% | 2.18% | 0.00% | NA |
Japonica Intermediate | 241 | 84.60% | 10.80% | 4.56% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0717368399 | G -> C | LOC_Os07g29570.1 | missense_variant ; p.Val793Leu; MODERATE | nonsynonymous_codon ; V793L | Average:56.121; most accessible tissue: Zhenshan97 young leaf, score: 85.364 | benign | -0.986 | TOLERATED | 0.25 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0717368399 | 3.15E-06 | NA | mr1092 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0717368399 | NA | 4.44E-07 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0717368399 | NA | 1.03E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0717368399 | NA | 9.24E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0717368399 | NA | 5.43E-07 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0717368399 | NA | 8.13E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0717368399 | NA | 5.92E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |