Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717317743:

Variant ID: vg0717317743 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17317743
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAATCAAAGGTGTTTTTGATTATTATTCTGTGATGAACAATTGGCATAGGAGATTATTGGTTTTGTTGTTTGGAATTTATTCACGAAGTGGTTTTGGA[G/A]
ATGATTGGATTTACAGGTGAATTACAGGTGCTGTTATTTTATGTGACCGGTCAGATCGGGCTATGTACGCTGGTCAGACCGGCGGTGATCGAGCGGTCAG

Reverse complement sequence

CTGACCGCTCGATCACCGCCGGTCTGACCAGCGTACATAGCCCGATCTGACCGGTCACATAAAATAACAGCACCTGTAATTCACCTGTAAATCCAATCAT[C/T]
TCCAAAACCACTTCGTGAATAAATTCCAAACAACAAAACCAATAATCTCCTATGCCAATTGTTCATCACAGAATAATAATCAAAAACACCTTTGATTTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.30%	40.70%	1.40%	1.61%	NA
All Indica	2759	92.60%	3.70%	1.16%	2.57%	NA
All Japonica	1512	0.90%	97.10%	1.92%	0.13%	NA
Aus	269	21.20%	76.60%	1.12%	1.12%	NA
Indica I	595	90.30%	1.50%	2.69%	5.55%	NA
Indica II	465	94.60%	4.70%	0.43%	0.22%	NA
Indica III	913	96.30%	1.50%	0.55%	1.64%	NA
Indica Intermediate	786	88.80%	7.30%	1.15%	2.80%	NA
Temperate Japonica	767	1.00%	98.70%	0.00%	0.26%	NA
Tropical Japonica	504	0.60%	96.00%	3.37%	0.00%	NA
Japonica Intermediate	241	0.80%	94.20%	4.98%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	38.90%	58.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717317743	G -> DEL	N	N	silent_mutation	Average:26.418; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0717317743	G -> A	LOC_Os07g29490.1	downstream_gene_variant ; 1179.0bp to feature; MODIFIER	silent_mutation	Average:26.418; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0717317743	G -> A	LOC_Os07g29500.1	downstream_gene_variant ; 236.0bp to feature; MODIFIER	silent_mutation	Average:26.418; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0717317743	G -> A	LOC_Os07g29490-LOC_Os07g29500	intergenic_region ; MODIFIER	silent_mutation	Average:26.418; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717317743	NA	3.58E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	4.43E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	2.82E-27	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	5.42E-07	2.06E-09	mr1082	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	8.31E-27	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	5.80E-07	4.29E-09	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	7.60E-30	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	2.32E-57	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	9.35E-09	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	9.88E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.22E-20	mr1131	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	5.07E-42	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	8.82E-30	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	2.19E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	5.22E-18	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	8.28E-11	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	3.15E-15	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.37E-34	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	3.96E-06	2.88E-07	mr1204	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.47E-30	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	9.97E-08	4.82E-11	mr1226	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	2.73E-61	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	4.84E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	2.01E-26	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	2.31E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	8.71E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	3.47E-27	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	4.22E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.47E-32	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	2.46E-06	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	5.66E-42	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	4.69E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.28E-32	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	4.60E-39	mr1620	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.10E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	8.55E-58	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.42E-20	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	2.17E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	3.47E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.95E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	9.18E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	5.09E-32	mr1878	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.33E-69	mr1970	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	6.25E-83	mr1973	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717317743	NA	1.33E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251