\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717100285:

Variant ID: vg0717100285 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17100285
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTATCAAAATTTTAGCAGGATTTCTTATATAGTTATCAAAATTTGGTAGCAAACTAAATGTAGCCACTTTTTTTGACAATTTTACTAAAATTTGGTAAG[G/T]
TTGAAAATGGCATCAAAGTGAACAGGCCCTTCGAGGTACAGCCAAAGCATGTGATGTGCTGCTGAGCCCATGACAACATGTGATCTGAATGCGCCATGGC

Reverse complement sequence

GCCATGGCGCATTCAGATCACATGTTGTCATGGGCTCAGCAGCACATCACATGCTTTGGCTGTACCTCGAAGGGCCTGTTCACTTTGATGCCATTTTCAA[C/A]
CTTACCAAATTTTAGTAAAATTGTCAAAAAAAGTGGCTACATTTAGTTTGCTACCAAATTTTGATAACTATATAAGAAATCCTGCTAAAATTTTGATAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 37.40% 0.63% 1.08% NA
All Indica  2759 92.90% 4.30% 0.91% 1.85% NA
All Japonica  1512 2.40% 97.40% 0.13% 0.00% NA
Aus  269 87.40% 12.30% 0.37% 0.00% NA
Indica I  595 95.50% 1.20% 0.50% 2.86% NA
Indica II  465 92.70% 2.60% 2.15% 2.58% NA
Indica III  913 95.60% 2.10% 0.66% 1.64% NA
Indica Intermediate  786 87.90% 10.40% 0.76% 0.89% NA
Temperate Japonica  767 0.70% 99.10% 0.26% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 44.40% 53.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717100285 G -> DEL N N silent_mutation Average:93.189; most accessible tissue: Callus, score: 96.425 N N N N
vg0717100285 G -> T LOC_Os07g29200.1 downstream_gene_variant ; 1565.0bp to feature; MODIFIER silent_mutation Average:93.189; most accessible tissue: Callus, score: 96.425 N N N N
vg0717100285 G -> T LOC_Os07g29200-LOC_Os07g29210 intergenic_region ; MODIFIER silent_mutation Average:93.189; most accessible tissue: Callus, score: 96.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0717100285 G T -0.07 -0.05 -0.05 -0.09 -0.08 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717100285 6.54E-07 NA mr1141 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 3.04E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 8.69E-06 NA mr1395 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 9.89E-06 7.11E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 4.02E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 3.57E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 1.28E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 2.94E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 4.76E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 4.26E-06 2.12E-78 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 2.29E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 4.66E-06 2.72E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 3.54E-51 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 2.27E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 6.33E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 1.89E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 2.80E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 2.42E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717100285 NA 1.05E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251