\
| Variant ID: vg0716738061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16738061 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGCCCGAGCTAATTCGAAACTTTCATATATACCTTCTCGTAGGAAACGGCACCACGGCAATCAAAACGGCAGCCGAAGAAAAAAGTTCCGTCGAAAGAC[G/A]
ACGAGGCACCAACTAACACAACCGGCTCAAACAAAAGCGAACGGTCAGCAAAGGCGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAAAAAGGATGAAGG
CCTTCATCCTTTTTATTCACGCTTCTCTCGCCCTTCCTTTTCTTCGCCTTTGCTGACCGTTCGCTTTTGTTTGAGCCGGTTGTGTTAGTTGGTGCCTCGT[C/T]
GTCTTTCGACGGAACTTTTTTCTTCGGCTGCCGTTTTGATTGCCGTGGTGCCGTTTCCTACGAGAAGGTATATATGAAAGTTTCGAATTAGCTCGGGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 8.10% | 17.71% | 2.52% | NA |
| All Indica | 2759 | 72.80% | 0.20% | 23.92% | 3.12% | NA |
| All Japonica | 1512 | 70.00% | 24.00% | 5.82% | 0.20% | NA |
| Aus | 269 | 63.60% | 0.00% | 26.02% | 10.41% | NA |
| Indica I | 595 | 79.70% | 0.00% | 17.48% | 2.86% | NA |
| Indica II | 465 | 73.50% | 0.20% | 21.72% | 4.52% | NA |
| Indica III | 913 | 66.80% | 0.40% | 31.54% | 1.20% | NA |
| Indica Intermediate | 786 | 74.00% | 0.00% | 21.25% | 4.71% | NA |
| Temperate Japonica | 767 | 91.30% | 2.00% | 6.39% | 0.39% | NA |
| Tropical Japonica | 504 | 41.90% | 53.80% | 4.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.00% | 32.00% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 4.20% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 14.40% | 17.78% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716738061 | G -> DEL | LOC_Os07g28600.1 | N | frameshift_variant | Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0716738061 | G -> A | LOC_Os07g28600.1 | missense_variant ; p.Asp100Asn; MODERATE | nonsynonymous_codon ; D100N | Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | benign |
0.403 |
TOLERATED | 0.06 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716738061 | 3.23E-06 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | NA | 1.67E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | 2.75E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | 6.93E-07 | NA | mr1085 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | 3.35E-07 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | NA | 1.16E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | NA | 8.95E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | NA | 1.11E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | NA | 2.11E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | 2.83E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | NA | 5.09E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | NA | 5.44E-06 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716738061 | NA | 1.18E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |