\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716595668:

Variant ID: vg0716595668 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16595668
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCAGCTTCTAACTTCTTAGTTTATTTTTCAGAATCTATAACTACATATTCTCAGAAGCTGTGGACTGTTTGAGGCAGCTTCTAGCGGAAGCATCTTTT[G/A]
GGAAAAGCTGCAGCTGGGACAAGCTCCCCCAAACAGGATTGCATCATTCACTATTCAGATATAGCCATTGGCTGTGTTTGCAACCCCACGTTCCCAACCC

Reverse complement sequence

GGGTTGGGAACGTGGGGTTGCAAACACAGCCAATGGCTATATCTGAATAGTGAATGATGCAATCCTGTTTGGGGGAGCTTGTCCCAGCTGCAGCTTTTCC[C/T]
AAAAGATGCTTCCGCTAGAAGCTGCCTCAAACAGTCCACAGCTTCTGAGAATATGTAGTTATAGATTCTGAAAAATAAACTAAGAAGTTAGAAGCTGGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 3.80% 0.00% 0.68% NA
All Indica  2759 99.50% 0.40% 0.00% 0.04% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.07% NA
Aus  269 30.90% 62.10% 0.00% 7.06% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.30% 0.00% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716595668 G -> DEL N N silent_mutation Average:54.273; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0716595668 G -> A LOC_Os07g28380.1 upstream_gene_variant ; 2857.0bp to feature; MODIFIER silent_mutation Average:54.273; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0716595668 G -> A LOC_Os07g28390.1 upstream_gene_variant ; 668.0bp to feature; MODIFIER silent_mutation Average:54.273; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0716595668 G -> A LOC_Os07g28400.1 downstream_gene_variant ; 4243.0bp to feature; MODIFIER silent_mutation Average:54.273; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0716595668 G -> A LOC_Os07g28390-LOC_Os07g28400 intergenic_region ; MODIFIER silent_mutation Average:54.273; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716595668 NA 2.96E-16 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 1.21E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 3.07E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 3.55E-21 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 5.56E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 4.55E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 8.38E-47 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 2.28E-06 7.65E-53 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 4.40E-06 1.28E-51 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 1.23E-29 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 2.99E-18 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 6.08E-06 1.43E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 3.81E-18 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 1.15E-16 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 9.03E-23 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 2.23E-21 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 2.59E-19 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 2.14E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 9.40E-06 9.49E-24 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 2.20E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 1.04E-08 6.72E-46 mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 2.58E-11 1.47E-69 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 2.45E-08 3.09E-40 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 1.68E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 1.43E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716595668 NA 2.38E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251