Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0716365835:

Variant ID: vg0716365835 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16365835
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.09, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGTGCCTTACCACGAGATTACTGTGACCTTACCATGGGATTTAAAATTTTTGAATTCATTTTGAAGATAAAATTCATGTGGTTTTCAGTGGTTACTAC[G/A]
GTAACTGTGTTATTGTGGGGAGGGGGAGGGGGTGACAACCTCCCCACAGACAGTTTGGGAAACCCTGGTCGACAATTGTTACAAAATGGTAAGGGAATAA

Reverse complement sequence

TTATTCCCTTACCATTTTGTAACAATTGTCGACCAGGGTTTCCCAAACTGTCTGTGGGGAGGTTGTCACCCCCTCCCCCTCCCCACAATAACACAGTTAC[C/T]
GTAGTAACCACTGAAAACCACATGAATTTTATCTTCAAAATGAATTCAAAAATTTTAAATCCCATGGTAAGGTCACAGTAATCTCGTGGTAAGGCACAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.00%	32.90%	0.04%	0.00%	NA
All Indica	2759	53.10%	46.90%	0.07%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	13.80%	86.20%	0.00%	0.00%	NA
Indica I	595	60.80%	39.20%	0.00%	0.00%	NA
Indica II	465	18.10%	81.90%	0.00%	0.00%	NA
Indica III	913	68.20%	31.80%	0.00%	0.00%	NA
Indica Intermediate	786	50.30%	49.50%	0.25%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716365835	G -> A	LOC_Os07g28050.1	upstream_gene_variant ; 2841.0bp to feature; MODIFIER	silent_mutation	Average:48.665; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0716365835	G -> A	LOC_Os07g28060.1	upstream_gene_variant ; 2627.0bp to feature; MODIFIER	silent_mutation	Average:48.665; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0716365835	G -> A	LOC_Os07g28050-LOC_Os07g28060	intergenic_region ; MODIFIER	silent_mutation	Average:48.665; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716365835	NA	3.68E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716365835	NA	3.39E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716365835	2.32E-06	NA	mr1705	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716365835	1.95E-06	8.74E-07	mr1705	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716365835	NA	7.60E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716365835	NA	2.57E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716365835	4.22E-07	NA	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716365835	6.14E-07	2.03E-11	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251