\
| Variant ID: vg0716091815 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16091815 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCAGCACACAAGAAGACAAACGAAAAACAGCGGAAGACTAGGGCGACGACCACAGGCGCTTGACGGCAGGCACGAGTTAGACACCAAAGCCTTCATCTTC[T/C,A]
AGGAACTCCTCTTCTGGGTTTGCGAAAAATTGAGCAAGACTGAGTACAACCACCGTACTCAACAAGACACACCCACAAGTGTAGAATAAATGCAAGGGAG
CTCCCTTGCATTTATTCTACACTTGTGGGTGTGTCTTGTTGAGTACGGTGGTTGTACTCAGTCTTGCTCAATTTTTCGCAAACCCAGAAGAGGAGTTCCT[A/G,T]
GAAGATGAAGGCTTTGGTGTCTAACTCGTGCCTGCCGTCAAGCGCCTGTGGTCGTCGCCCTAGTCTTCCGCTGTTTTTCGTTTGTCTTCTTGTGTGCTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.70% | 9.50% | 5.33% | 50.32% | A: 0.11% |
| All Indica | 2759 | 5.60% | 9.50% | 8.26% | 76.48% | A: 0.18% |
| All Japonica | 1512 | 87.80% | 11.60% | 0.00% | 0.66% | NA |
| Aus | 269 | 9.30% | 3.00% | 7.06% | 80.67% | NA |
| Indica I | 595 | 6.20% | 1.50% | 10.76% | 81.51% | NA |
| Indica II | 465 | 8.40% | 2.60% | 9.25% | 79.78% | NA |
| Indica III | 913 | 2.80% | 11.80% | 5.81% | 79.19% | A: 0.33% |
| Indica Intermediate | 786 | 6.60% | 16.90% | 8.65% | 67.56% | A: 0.25% |
| Temperate Japonica | 767 | 78.00% | 21.50% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 98.20% | 1.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.10% | 1.20% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 51.10% | 6.70% | 3.33% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716091815 | T -> DEL | N | N | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0716091815 | T -> A | LOC_Os07g27530.1 | upstream_gene_variant ; 400.0bp to feature; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0716091815 | T -> A | LOC_Os07g27540.1 | upstream_gene_variant ; 2831.0bp to feature; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0716091815 | T -> A | LOC_Os07g27520.1 | downstream_gene_variant ; 2477.0bp to feature; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0716091815 | T -> A | LOC_Os07g27530-LOC_Os07g27540 | intergenic_region ; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0716091815 | T -> C | LOC_Os07g27530.1 | upstream_gene_variant ; 400.0bp to feature; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0716091815 | T -> C | LOC_Os07g27540.1 | upstream_gene_variant ; 2831.0bp to feature; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0716091815 | T -> C | LOC_Os07g27520.1 | downstream_gene_variant ; 2477.0bp to feature; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0716091815 | T -> C | LOC_Os07g27530-LOC_Os07g27540 | intergenic_region ; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716091815 | NA | 1.40E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716091815 | 2.02E-06 | 1.15E-06 | mr1528 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716091815 | 4.94E-06 | NA | mr1878 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716091815 | NA | 5.06E-06 | mr1990 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |