\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716091815:

Variant ID: vg0716091815 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16091815
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGCACACAAGAAGACAAACGAAAAACAGCGGAAGACTAGGGCGACGACCACAGGCGCTTGACGGCAGGCACGAGTTAGACACCAAAGCCTTCATCTTC[T/C,A]
AGGAACTCCTCTTCTGGGTTTGCGAAAAATTGAGCAAGACTGAGTACAACCACCGTACTCAACAAGACACACCCACAAGTGTAGAATAAATGCAAGGGAG

Reverse complement sequence

CTCCCTTGCATTTATTCTACACTTGTGGGTGTGTCTTGTTGAGTACGGTGGTTGTACTCAGTCTTGCTCAATTTTTCGCAAACCCAGAAGAGGAGTTCCT[A/G,T]
GAAGATGAAGGCTTTGGTGTCTAACTCGTGCCTGCCGTCAAGCGCCTGTGGTCGTCGCCCTAGTCTTCCGCTGTTTTTCGTTTGTCTTCTTGTGTGCTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.70% 9.50% 5.33% 50.32% A: 0.11%
All Indica  2759 5.60% 9.50% 8.26% 76.48% A: 0.18%
All Japonica  1512 87.80% 11.60% 0.00% 0.66% NA
Aus  269 9.30% 3.00% 7.06% 80.67% NA
Indica I  595 6.20% 1.50% 10.76% 81.51% NA
Indica II  465 8.40% 2.60% 9.25% 79.78% NA
Indica III  913 2.80% 11.80% 5.81% 79.19% A: 0.33%
Indica Intermediate  786 6.60% 16.90% 8.65% 67.56% A: 0.25%
Temperate Japonica  767 78.00% 21.50% 0.00% 0.52% NA
Tropical Japonica  504 98.20% 1.40% 0.00% 0.40% NA
Japonica Intermediate  241 97.10% 1.20% 0.00% 1.66% NA
VI/Aromatic  96 91.70% 0.00% 2.08% 6.25% NA
Intermediate  90 51.10% 6.70% 3.33% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716091815 T -> DEL N N silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0716091815 T -> A LOC_Os07g27530.1 upstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0716091815 T -> A LOC_Os07g27540.1 upstream_gene_variant ; 2831.0bp to feature; MODIFIER silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0716091815 T -> A LOC_Os07g27520.1 downstream_gene_variant ; 2477.0bp to feature; MODIFIER silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0716091815 T -> A LOC_Os07g27530-LOC_Os07g27540 intergenic_region ; MODIFIER silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0716091815 T -> C LOC_Os07g27530.1 upstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0716091815 T -> C LOC_Os07g27540.1 upstream_gene_variant ; 2831.0bp to feature; MODIFIER silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0716091815 T -> C LOC_Os07g27520.1 downstream_gene_variant ; 2477.0bp to feature; MODIFIER silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0716091815 T -> C LOC_Os07g27530-LOC_Os07g27540 intergenic_region ; MODIFIER silent_mutation Average:18.133; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716091815 NA 1.40E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716091815 2.02E-06 1.15E-06 mr1528 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716091815 4.94E-06 NA mr1878 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716091815 NA 5.06E-06 mr1990 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251