\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715967548:

Variant ID: vg0715967548 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15967548
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTAATGGGATGGAAGGAGAGCTGGGTGTTGGTGATATGCCCTAGAGACAATTATAGAGCAAGGCACCGCTATATATAAAACTATATGTATACATAT[A/T]
AGTATATTTAATAATGAATCAAATGATAGAAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGACGAACGGTCAAACATATTTAAAAAAGTCAACGG

Reverse complement sequence

CCGTTGACTTTTTTAAATATGTTTGACCGTTCGTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTCATTATTAAATATACT[T/A]
ATATGTATACATATAGTTTTATATATAGCGGTGCCTTGCTCTATAATTGTCTCTAGGGCATATCACCAACACCCAGCTCTCCTTCCATCCCATTAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 37.00% 0.23% 3.87% NA
All Indica  2759 95.70% 3.40% 0.11% 0.76% NA
All Japonica  1512 0.90% 99.00% 0.00% 0.07% NA
Aus  269 28.30% 9.30% 2.60% 59.85% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 96.60% 3.20% 0.00% 0.22% NA
Indica III  913 98.60% 1.00% 0.00% 0.44% NA
Indica Intermediate  786 89.60% 8.10% 0.25% 2.04% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715967548 A -> DEL N N silent_mutation Average:59.296; most accessible tissue: Callus, score: 82.947 N N N N
vg0715967548 A -> T LOC_Os07g27400.1 upstream_gene_variant ; 3732.0bp to feature; MODIFIER silent_mutation Average:59.296; most accessible tissue: Callus, score: 82.947 N N N N
vg0715967548 A -> T LOC_Os07g27410.1 upstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:59.296; most accessible tissue: Callus, score: 82.947 N N N N
vg0715967548 A -> T LOC_Os07g27400-LOC_Os07g27410 intergenic_region ; MODIFIER silent_mutation Average:59.296; most accessible tissue: Callus, score: 82.947 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715967548 NA 2.27E-22 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 2.80E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 3.09E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 3.85E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 1.53E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 1.55E-21 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 2.33E-29 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 2.39E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 3.02E-07 3.75E-08 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 2.85E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 1.03E-43 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 7.59E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 4.32E-06 7.42E-07 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 1.84E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 1.14E-17 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 NA 3.12E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715967548 3.08E-06 NA mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251