\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715843159:

Variant ID: vg0715843159 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15843159
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATTTCCAACAAGTAAATAAATGCAGAACAATGGCCTCAGATATATGAAGAATGTGAATTACTTCCTCCGTTTCACAATATAAGTCATTCTAGCATTTC[C/T]
CACATTCATATTGATGTTAATGAATCTAGATAGATATATATGTCTAGATTTATCAACATTAATATGAATGTGGGAAATGCTAGAATGACTTACACTGTGA

Reverse complement sequence

TCACAGTGTAAGTCATTCTAGCATTTCCCACATTCATATTAATGTTGATAAATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATGTG[G/A]
GAAATGCTAGAATGACTTATATTGTGAAACGGAGGAAGTAATTCACATTCTTCATATATCTGAGGCCATTGTTCTGCATTTATTTACTTGTTGGAAATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 35.00% 0.38% 0.25% NA
All Indica  2759 96.00% 3.40% 0.25% 0.25% NA
All Japonica  1512 6.70% 93.10% 0.07% 0.13% NA
Aus  269 88.50% 8.90% 2.60% 0.00% NA
Indica I  595 98.50% 1.20% 0.00% 0.34% NA
Indica II  465 95.10% 4.30% 0.22% 0.43% NA
Indica III  913 99.00% 0.80% 0.11% 0.11% NA
Indica Intermediate  786 91.30% 7.80% 0.64% 0.25% NA
Temperate Japonica  767 11.50% 88.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.10% 0.41% 0.83% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 50.00% 44.40% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715843159 C -> DEL N N silent_mutation Average:28.791; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0715843159 C -> T LOC_Os07g27250.1 upstream_gene_variant ; 1191.0bp to feature; MODIFIER silent_mutation Average:28.791; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0715843159 C -> T LOC_Os07g27260.1 upstream_gene_variant ; 4241.0bp to feature; MODIFIER silent_mutation Average:28.791; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0715843159 C -> T LOC_Os07g27250-LOC_Os07g27260 intergenic_region ; MODIFIER silent_mutation Average:28.791; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715843159 4.07E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 5.42E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 NA 9.21E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 NA 5.83E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 NA 1.34E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 NA 7.45E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 NA 1.88E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 8.35E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 3.81E-06 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 6.27E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 3.98E-06 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 NA 6.91E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 5.66E-08 NA mr1613_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843159 NA 2.56E-33 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251