\
| Variant ID: vg0715843159 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15843159 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCATTTCCAACAAGTAAATAAATGCAGAACAATGGCCTCAGATATATGAAGAATGTGAATTACTTCCTCCGTTTCACAATATAAGTCATTCTAGCATTTC[C/T]
CACATTCATATTGATGTTAATGAATCTAGATAGATATATATGTCTAGATTTATCAACATTAATATGAATGTGGGAAATGCTAGAATGACTTACACTGTGA
TCACAGTGTAAGTCATTCTAGCATTTCCCACATTCATATTAATGTTGATAAATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATGTG[G/A]
GAAATGCTAGAATGACTTATATTGTGAAACGGAGGAAGTAATTCACATTCTTCATATATCTGAGGCCATTGTTCTGCATTTATTTACTTGTTGGAAATGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 35.00% | 0.38% | 0.25% | NA |
| All Indica | 2759 | 96.00% | 3.40% | 0.25% | 0.25% | NA |
| All Japonica | 1512 | 6.70% | 93.10% | 0.07% | 0.13% | NA |
| Aus | 269 | 88.50% | 8.90% | 2.60% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.20% | 0.00% | 0.34% | NA |
| Indica II | 465 | 95.10% | 4.30% | 0.22% | 0.43% | NA |
| Indica III | 913 | 99.00% | 0.80% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 91.30% | 7.80% | 0.64% | 0.25% | NA |
| Temperate Japonica | 767 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.10% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 8.30% | 90.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 44.40% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715843159 | C -> DEL | N | N | silent_mutation | Average:28.791; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0715843159 | C -> T | LOC_Os07g27250.1 | upstream_gene_variant ; 1191.0bp to feature; MODIFIER | silent_mutation | Average:28.791; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0715843159 | C -> T | LOC_Os07g27260.1 | upstream_gene_variant ; 4241.0bp to feature; MODIFIER | silent_mutation | Average:28.791; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0715843159 | C -> T | LOC_Os07g27250-LOC_Os07g27260 | intergenic_region ; MODIFIER | silent_mutation | Average:28.791; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715843159 | 4.07E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | 5.42E-06 | NA | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | NA | 9.21E-06 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | NA | 5.83E-16 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | NA | 1.34E-18 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | NA | 7.45E-23 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | NA | 1.88E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | 8.35E-06 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | 3.81E-06 | NA | mr1071_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | 6.27E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | 3.98E-06 | NA | mr1203_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | NA | 6.91E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | 5.66E-08 | NA | mr1613_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715843159 | NA | 2.56E-33 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |