\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715843139:

Variant ID: vg0715843139 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15843139
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTGACATCATTGAGCCTCATTTCCAACAAGTAAATAAATGCAGAACAATGGCCTCAGATATATGAAGAATGTGAATTACTTCCTCCGTTTCACAAT[A/G]
TAAGTCATTCTAGCATTTCCCACATTCATATTGATGTTAATGAATCTAGATAGATATATATGTCTAGATTTATCAACATTAATATGAATGTGGGAAATGC

Reverse complement sequence

GCATTTCCCACATTCATATTAATGTTGATAAATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATGTGGGAAATGCTAGAATGACTTA[T/C]
ATTGTGAAACGGAGGAAGTAATTCACATTCTTCATATATCTGAGGCCATTGTTCTGCATTTATTTACTTGTTGGAAATGAGGCTCAATGATGTCAAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 34.90% 0.34% 0.36% NA
All Indica  2759 96.10% 3.30% 0.25% 0.33% NA
All Japonica  1512 6.70% 93.10% 0.00% 0.20% NA
Aus  269 88.50% 8.90% 2.60% 0.00% NA
Indica I  595 98.50% 1.20% 0.00% 0.34% NA
Indica II  465 95.30% 3.90% 0.22% 0.65% NA
Indica III  913 99.00% 0.80% 0.11% 0.11% NA
Indica Intermediate  786 91.30% 7.60% 0.64% 0.38% NA
Temperate Japonica  767 11.50% 88.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.10% 0.00% 1.24% NA
VI/Aromatic  96 8.30% 90.60% 0.00% 1.04% NA
Intermediate  90 50.00% 43.30% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715843139 A -> DEL N N silent_mutation Average:29.206; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0715843139 A -> G LOC_Os07g27250.1 upstream_gene_variant ; 1171.0bp to feature; MODIFIER silent_mutation Average:29.206; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0715843139 A -> G LOC_Os07g27260.1 upstream_gene_variant ; 4261.0bp to feature; MODIFIER silent_mutation Average:29.206; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0715843139 A -> G LOC_Os07g27250-LOC_Os07g27260 intergenic_region ; MODIFIER silent_mutation Average:29.206; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715843139 NA 4.20E-37 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 8.02E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 9.16E-06 8.16E-56 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 2.25E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 9.28E-06 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 1.16E-25 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 1.20E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 4.27E-06 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 1.48E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 1.63E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 7.51E-20 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 4.42E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 2.16E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 1.82E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 1.48E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 7.02E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 8.55E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 1.25E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 2.65E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 1.05E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 4.01E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 3.40E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 2.29E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 2.19E-34 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139 NA 5.68E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251