Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715843139:

Variant ID: vg0715843139 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15843139
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTTGACATCATTGAGCCTCATTTCCAACAAGTAAATAAATGCAGAACAATGGCCTCAGATATATGAAGAATGTGAATTACTTCCTCCGTTTCACAAT[A/G]
TAAGTCATTCTAGCATTTCCCACATTCATATTGATGTTAATGAATCTAGATAGATATATATGTCTAGATTTATCAACATTAATATGAATGTGGGAAATGC

Reverse complement sequence

GCATTTCCCACATTCATATTAATGTTGATAAATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATGTGGGAAATGCTAGAATGACTTA[T/C]
ATTGTGAAACGGAGGAAGTAATTCACATTCTTCATATATCTGAGGCCATTGTTCTGCATTTATTTACTTGTTGGAAATGAGGCTCAATGATGTCAAATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	34.90%	0.34%	0.36%	NA
All Indica	2759	96.10%	3.30%	0.25%	0.33%	NA
All Japonica	1512	6.70%	93.10%	0.00%	0.20%	NA
Aus	269	88.50%	8.90%	2.60%	0.00%	NA
Indica I	595	98.50%	1.20%	0.00%	0.34%	NA
Indica II	465	95.30%	3.90%	0.22%	0.65%	NA
Indica III	913	99.00%	0.80%	0.11%	0.11%	NA
Indica Intermediate	786	91.30%	7.60%	0.64%	0.38%	NA
Temperate Japonica	767	11.50%	88.50%	0.00%	0.00%	NA
Tropical Japonica	504	2.00%	98.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.10%	0.00%	1.24%	NA
VI/Aromatic	96	8.30%	90.60%	0.00%	1.04%	NA
Intermediate	90	50.00%	43.30%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715843139	A -> DEL	N	N	silent_mutation	Average:29.206; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0715843139	A -> G	LOC_Os07g27250.1	upstream_gene_variant ; 1171.0bp to feature; MODIFIER	silent_mutation	Average:29.206; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0715843139	A -> G	LOC_Os07g27260.1	upstream_gene_variant ; 4261.0bp to feature; MODIFIER	silent_mutation	Average:29.206; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0715843139	A -> G	LOC_Os07g27250-LOC_Os07g27260	intergenic_region ; MODIFIER	silent_mutation	Average:29.206; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715843139	NA	4.20E-37	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	8.02E-06	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	9.16E-06	8.16E-56	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	2.25E-21	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	9.28E-06	NA	mr1211	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	1.16E-25	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	1.20E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	4.27E-06	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	1.48E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	1.63E-66	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	7.51E-20	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	4.42E-57	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	2.16E-06	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	1.82E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	1.48E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	7.02E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	8.55E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	1.25E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	2.65E-39	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	1.05E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	4.01E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	3.40E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	2.29E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	2.19E-34	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715843139	NA	5.68E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251