Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0715701951:

Variant ID: vg0715701951 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15701951
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCTACCTCAGGTATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTGAGAACAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTC[A/G]
AAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGTAAACACAGAGAGAAGTAATAAAGTTGTCATCCACTTTAAGAGTTCTTCGATTTGTGTTTCACCGA

Reverse complement sequence

TCGGTGAAACACAAATCGAAGAACTCTTAAAGTGGATGACAACTTTATTACTTCTCTCTGTGTTTACAAAGTGCACCAACAGCACTCCTTACAAAAATTT[T/C]
GACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGTTCTCAAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATACCTGAGGTAGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 12.80% 0.80% 0.00% NA
All Indica  2759 96.30% 2.50% 1.12% 0.00% NA
All Japonica  1512 65.60% 34.40% 0.00% 0.00% NA
Aus  269 97.40% 0.40% 2.23% 0.00% NA
Indica I  595 97.30% 1.20% 1.51% 0.00% NA
Indica II  465 96.80% 2.80% 0.43% 0.00% NA
Indica III  913 96.30% 2.50% 1.20% 0.00% NA
Indica Intermediate  786 95.40% 3.40% 1.15% 0.00% NA
Temperate Japonica  767 36.00% 64.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715701951 A -> G LOC_Os07g27090.1 upstream_gene_variant ; 2811.0bp to feature; MODIFIER silent_mutation Average:42.096; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg0715701951 A -> G LOC_Os07g27080.1 downstream_gene_variant ; 1911.0bp to feature; MODIFIER silent_mutation Average:42.096; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg0715701951 A -> G LOC_Os07g27080-LOC_Os07g27090 intergenic_region ; MODIFIER silent_mutation Average:42.096; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715701951 NA 7.44E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 1.82E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 5.31E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 4.91E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 8.06E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 8.11E-12 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 4.45E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 2.66E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 2.29E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 3.57E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 3.06E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 3.06E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 1.12E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 NA 3.79E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 2.66E-07 6.45E-10 mr1748_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715701951 4.09E-06 NA mr1748_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251