\
| Variant ID: vg0715701891 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15701891 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTAGAGGGTTTCCTAAGGTGTTTAGGACCCCTATTATGAGTTTGGTTCGTGGCTTTAGGTTGCCTACCTCAGGTATAAATAGAGGGGGAGCGTGAGGCTT[C/T]
CCGGTATCGCTTTTGAGAACAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCAAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGTAAACA
TGTTTACAAAGTGCACCAACAGCACTCCTTACAAAAATTTTGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGTTCTCAAAAGCGATACCGG[G/A]
AAGCCTCACGCTCCCCCTCTATTTATACCTGAGGTAGGCAACCTAAAGCCACGAACCAAACTCATAATAGGGGTCCTAAACACCTTAGGAAACCCTCTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 47.10% | 0.97% | 0.08% | NA |
| All Indica | 2759 | 79.30% | 19.20% | 1.30% | 0.14% | NA |
| All Japonica | 1512 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 78.10% | 18.20% | 3.72% | 0.00% | NA |
| Indica I | 595 | 94.10% | 4.40% | 1.51% | 0.00% | NA |
| Indica II | 465 | 91.60% | 6.90% | 1.51% | 0.00% | NA |
| Indica III | 913 | 69.10% | 29.60% | 1.10% | 0.22% | NA |
| Indica Intermediate | 786 | 72.80% | 25.70% | 1.27% | 0.25% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 61.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715701891 | C -> DEL | N | N | silent_mutation | Average:32.467; most accessible tissue: Zhenshan97 flower, score: 44.193 | N | N | N | N |
| vg0715701891 | C -> T | LOC_Os07g27090.1 | upstream_gene_variant ; 2871.0bp to feature; MODIFIER | silent_mutation | Average:32.467; most accessible tissue: Zhenshan97 flower, score: 44.193 | N | N | N | N |
| vg0715701891 | C -> T | LOC_Os07g27080.1 | downstream_gene_variant ; 1851.0bp to feature; MODIFIER | silent_mutation | Average:32.467; most accessible tissue: Zhenshan97 flower, score: 44.193 | N | N | N | N |
| vg0715701891 | C -> T | LOC_Os07g27080-LOC_Os07g27090 | intergenic_region ; MODIFIER | silent_mutation | Average:32.467; most accessible tissue: Zhenshan97 flower, score: 44.193 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715701891 | NA | 1.33E-42 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 4.84E-08 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.07E-29 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 2.54E-32 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 2.89E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 8.57E-08 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.68E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.90E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.94E-39 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 5.93E-26 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.08E-08 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 2.62E-26 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 7.85E-07 | mr1181 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 4.25E-06 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.90E-31 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.65E-06 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 7.56E-12 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 4.53E-06 | mr1233 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 4.17E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.74E-08 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | 8.08E-06 | 2.83E-06 | mr1344 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | 6.85E-07 | 7.19E-09 | mr1344 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 2.42E-06 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 8.25E-26 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 2.69E-19 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 2.21E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.83E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 2.86E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 5.99E-54 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.39E-25 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 3.83E-09 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 7.10E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 1.46E-56 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715701891 | NA | 2.30E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |