\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715502728:

Variant ID: vg0715502728 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15502728
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TATACAGGTTCAGGCCTTCTTATTCAAGAAGTAATACCCTACTCCTGTCCGGGGATGAATCCGCCGAGTGTATTATTGAATGTATAATCTCCAAGAAAGA[T/A]
CATGTCCCAAGAAGGACTCGGACCCCTCCTTATATAGGGAGAGGTGTCCGTATTACAATAGTATAACTCATATCCGTAACAGAATATGAGTTACAGATAA

Reverse complement sequence

TTATCTGTAACTCATATTCTGTTACGGATATGAGTTATACTATTGTAATACGGACACCTCTCCCTATATAAGGAGGGGTCCGAGTCCTTCTTGGGACATG[A/T]
TCTTTCTTGGAGATTATACATTCAATAATACACTCGGCGGATTCATCCCCGGACAGGAGTAGGGTATTACTTCTTGAATAAGAAGGCCTGAACCTGTATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.00% 0.40% 0.83% 75.79% NA
All Indica  2759 13.80% 0.70% 1.38% 84.16% NA
All Japonica  1512 44.20% 0.00% 0.07% 55.69% NA
Aus  269 4.80% 0.00% 0.00% 95.17% NA
Indica I  595 28.40% 0.80% 2.69% 68.07% NA
Indica II  465 13.30% 0.90% 1.51% 84.30% NA
Indica III  913 2.00% 0.00% 0.22% 97.81% NA
Indica Intermediate  786 16.80% 1.10% 1.65% 80.41% NA
Temperate Japonica  767 75.00% 0.00% 0.00% 25.03% NA
Tropical Japonica  504 5.40% 0.00% 0.00% 94.64% NA
Japonica Intermediate  241 27.80% 0.00% 0.41% 71.78% NA
VI/Aromatic  96 3.10% 0.00% 0.00% 96.88% NA
Intermediate  90 23.30% 0.00% 0.00% 76.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715502728 T -> DEL N N silent_mutation Average:21.456; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0715502728 T -> A LOC_Os07g26810-LOC_Os07g26820 intergenic_region ; MODIFIER silent_mutation Average:21.456; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715502728 NA 1.61E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 NA 9.38E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 NA 2.62E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 8.39E-06 1.68E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 6.04E-06 6.03E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 3.68E-06 3.68E-06 mr1311_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 4.06E-06 4.05E-06 mr1312_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 NA 6.15E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 2.67E-06 2.67E-06 mr1374_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 NA 7.54E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 8.18E-06 8.18E-06 mr1663_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 2.44E-06 2.44E-06 mr1738_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 5.02E-06 5.02E-06 mr1753_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 5.18E-06 5.18E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 1.20E-06 1.19E-06 mr1832_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 2.38E-06 2.38E-06 mr1843_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 4.79E-06 4.79E-06 mr1847_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715502728 NA 7.73E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251