Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0715448729:

Variant ID: vg0715448729 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 15448729
Reference Allele: TGGCGTAAAATTA	Alternative Allele: T
Primary Allele: TGGCGTAAAATTA	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACCACCTTCAAAACCGCCGAGAGATCTCATTTGCACCGTTTTTGATAATTTAGGGACCGGTTATATCTGGTTTTGGGGTTAAGGATGAAAATCGGATT[TGGCGTAAAATTA/T]
AGGGACCTAAGATGAACTTATTCCTTCTTTTTTCTTCTCTCTTTCGAGCCAATCATTTGGGCCGACCGTTCGGCCCATAGGTTACAAACAGGCCGGCCCG

Reverse complement sequence

CGGGCCGGCCTGTTTGTAACCTATGGGCCGAACGGTCGGCCCAAATGATTGGCTCGAAAGAGAGAAGAAAAAAGAAGGAATAAGTTCATCTTAGGTCCCT[TAATTTTACGCCA/A]
AATCCGATTTTCATCCTTAACCCCAAAACCAGATATAACCGGTCCCTAAATTATCAAAAACGGTGCAAATGAGATCTCTCGGCGGTTTTGAAGGTGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of TGGCGTAAAATTA(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.40%	2.00%	1.50%	22.05%	NA
All Indica	2759	89.00%	3.40%	1.99%	5.58%	NA
All Japonica	1512	43.30%	0.10%	0.66%	55.95%	NA
Aus	269	93.30%	0.00%	0.74%	5.95%	NA
Indica I	595	86.60%	9.20%	2.18%	2.02%	NA
Indica II	465	84.30%	0.00%	5.16%	10.54%	NA
Indica III	913	93.30%	1.10%	0.55%	5.04%	NA
Indica Intermediate	786	88.50%	3.80%	1.65%	5.98%	NA
Temperate Japonica	767	71.60%	0.00%	0.26%	28.16%	NA
Tropical Japonica	504	7.50%	0.00%	1.39%	91.07%	NA
Japonica Intermediate	241	28.20%	0.40%	0.41%	70.95%	NA
VI/Aromatic	96	87.50%	0.00%	0.00%	12.50%	NA
Intermediate	90	80.00%	0.00%	4.44%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715448729	TGGCGTAAAATTA -> DEL	N	N	silent_mutation	Average:72.442; most accessible tissue: Callus, score: 98.813	N	N	N	N
vg0715448729	TGGCGTAAAATTA -> T	LOC_Os07g26730.1	upstream_gene_variant ; 1984.0bp to feature; MODIFIER	silent_mutation	Average:72.442; most accessible tissue: Callus, score: 98.813	N	N	N	N
vg0715448729	TGGCGTAAAATTA -> T	LOC_Os07g26740.1	upstream_gene_variant ; 229.0bp to feature; MODIFIER	silent_mutation	Average:72.442; most accessible tissue: Callus, score: 98.813	N	N	N	N
vg0715448729	TGGCGTAAAATTA -> T	LOC_Os07g26750.1	downstream_gene_variant ; 3220.0bp to feature; MODIFIER	silent_mutation	Average:72.442; most accessible tissue: Callus, score: 98.813	N	N	N	N
vg0715448729	TGGCGTAAAATTA -> T	LOC_Os07g26730-LOC_Os07g26740	intergenic_region ; MODIFIER	silent_mutation	Average:72.442; most accessible tissue: Callus, score: 98.813	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0715448729	TGGCG*	T	-0.03	-0.13	-0.15	-0.06	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715448729	NA	3.67E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715448729	1.38E-06	9.03E-08	mr1518	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715448729	NA	1.84E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251