\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715326938:

Variant ID: vg0715326938 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15326938
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATATTAGCAGGCGCCCTCCCCACGATGGCATGGATCAATTTCTGGATACAGGTCTTGGCTTGAAGCAATCGTCTCAATGAATTGAGCCATTATCGATG[C/T]
CTTTTTTAGTCGTGCACTCCCCATCTGTGTCGGTTCTCAATCTAGCACCAATGAGTCCCCTCATTAGTCCCCATGGTGCCAGTTGAGGAATCCGAAACCT

Reverse complement sequence

AGGTTTCGGATTCCTCAACTGGCACCATGGGGACTAATGAGGGGACTCATTGGTGCTAGATTGAGAACCGACACAGATGGGGAGTGCACGACTAAAAAAG[G/A]
CATCGATAATGGCTCAATTCATTGAGACGATTGCTTCAAGCCAAGACCTGTATCCAGAAATTGATCCATGCCATCGTGGGGAGGGCGCCTGCTAATATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 0.20% 0.11% 4.19% NA
All Indica  2759 93.60% 0.30% 0.14% 5.91% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 88.10% 0.00% 0.37% 11.52% NA
Indica I  595 95.60% 0.30% 0.17% 3.87% NA
Indica II  465 98.90% 0.40% 0.22% 0.43% NA
Indica III  913 91.00% 0.10% 0.11% 8.76% NA
Indica Intermediate  786 92.00% 0.50% 0.13% 7.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 0.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715326938 C -> DEL N N silent_mutation Average:51.392; most accessible tissue: Callus, score: 97.683 N N N N
vg0715326938 C -> T LOC_Os07g26600.1 upstream_gene_variant ; 3841.0bp to feature; MODIFIER silent_mutation Average:51.392; most accessible tissue: Callus, score: 97.683 N N N N
vg0715326938 C -> T LOC_Os07g26600-LOC_Os07g26610 intergenic_region ; MODIFIER silent_mutation Average:51.392; most accessible tissue: Callus, score: 97.683 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715326938 NA 7.19E-22 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 3.49E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 7.41E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 2.57E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 8.27E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 1.10E-06 mr1344 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 6.87E-22 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 2.27E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 1.31E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 7.74E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 5.93E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 2.19E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 8.37E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 2.31E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 1.70E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 1.13E-26 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 3.32E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 2.87E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 6.58E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715326938 NA 9.61E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251