Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715014794:

Variant ID: vg0715014794 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15014794
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGACCAAGTGTAGCTCATATGAATAGCTTCTGATCTGAGTGATTATCCTTTATGGGATACTCCAAAATAGATATAACAATTGAATTCCGACTGGCGCAA[G/A]
TATTAGGCTGATAACCCATACGGGGAATAATAAATAGTCTAGTCTTTGAGCATAGAAAATAGACCCATGATCATCAAATTCATGTTGCATGTATCCGGAA

Reverse complement sequence

TTCCGGATACATGCAACATGAATTTGATGATCATGGGTCTATTTTCTATGCTCAAAGACTAGACTATTTATTATTCCCCGTATGGGTTATCAGCCTAATA[C/T]
TTGCGCCAGTCGGAATTCAATTGTTATATCTATTTTGGAGTATCCCATAAAGGATAATCACTCAGATCAGAAGCTATTCATATGAGCTACACTTGGTCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.20%	4.40%	6.18%	42.21%	NA
All Indica	2759	25.30%	1.00%	8.37%	65.28%	NA
All Japonica	1512	93.60%	0.10%	0.20%	6.15%	NA
Aus	269	4.80%	65.40%	7.06%	22.68%	NA
Indica I	595	21.50%	0.20%	6.72%	71.60%	NA
Indica II	465	17.00%	0.20%	3.44%	79.35%	NA
Indica III	913	27.50%	0.80%	10.41%	61.34%	NA
Indica Intermediate	786	30.70%	2.40%	10.18%	56.74%	NA
Temperate Japonica	767	88.30%	0.00%	0.00%	11.73%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	97.50%	0.40%	1.24%	0.83%	NA
VI/Aromatic	96	47.90%	0.00%	39.58%	12.50%	NA
Intermediate	90	66.70%	1.10%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715014794	G -> DEL	N	N	silent_mutation	Average:25.344; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0715014794	G -> A	LOC_Os07g26130.1	downstream_gene_variant ; 4189.0bp to feature; MODIFIER	silent_mutation	Average:25.344; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0715014794	G -> A	LOC_Os07g26120-LOC_Os07g26130	intergenic_region ; MODIFIER	silent_mutation	Average:25.344; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715014794	NA	5.04E-40	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	2.44E-44	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	6.74E-43	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	3.40E-29	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	6.30E-17	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	3.65E-21	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	5.64E-09	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	3.18E-23	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	4.31E-06	NA	mr1270_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	6.63E-22	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	4.42E-14	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	2.70E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	5.98E-38	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	4.29E-06	7.13E-58	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	9.17E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	4.77E-37	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	9.63E-08	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	7.81E-10	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	1.70E-10	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715014794	NA	2.22E-16	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251