Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0714748935:

Variant ID: vg0714748935 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14748935
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAACCTGTGGCTATAAATATGTATCCAGAAATAGTAAATGTGCTCCCAAATATAAAAGTAGACATGTTTGAACATGTCTCAAACGTAAAAAATATGCC[C/G]
TACAGACAATTGTTTTGCAGGTCGTTTTGTGAGCCTTGATATACATCCTTGCTCATTGGTGCTATTAGGCATGGCTGTGCATGTGTGGTTTAGTGGTTGT

Reverse complement sequence

ACAACCACTAAACCACACATGCACAGCCATGCCTAATAGCACCAATGAGCAAGGATGTATATCAAGGCTCACAAAACGACCTGCAAAACAATTGTCTGTA[G/C]
GGCATATTTTTTACGTTTGAGACATGTTCAAACATGTCTACTTTTATATTTGGGAGCACATTTACTATTTCTGGATACATATTTATAGCCACAGGTTTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 2.70% 1.61% 0.00% NA
All Indica  2759 92.60% 4.70% 2.68% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 78.80% 14.50% 6.72% 0.00% NA
Indica II  465 97.20% 0.90% 1.94% 0.00% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 92.10% 5.00% 2.93% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714748935 C -> G LOC_Os07g25710.1 upstream_gene_variant ; 4818.0bp to feature; MODIFIER silent_mutation Average:52.23; most accessible tissue: Callus, score: 74.581 N N N N
vg0714748935 C -> G LOC_Os07g25710.2 upstream_gene_variant ; 4818.0bp to feature; MODIFIER silent_mutation Average:52.23; most accessible tissue: Callus, score: 74.581 N N N N
vg0714748935 C -> G LOC_Os07g25710.3 upstream_gene_variant ; 4818.0bp to feature; MODIFIER silent_mutation Average:52.23; most accessible tissue: Callus, score: 74.581 N N N N
vg0714748935 C -> G LOC_Os07g25710.4 upstream_gene_variant ; 4818.0bp to feature; MODIFIER silent_mutation Average:52.23; most accessible tissue: Callus, score: 74.581 N N N N
vg0714748935 C -> G LOC_Os07g25700.1 downstream_gene_variant ; 2699.0bp to feature; MODIFIER silent_mutation Average:52.23; most accessible tissue: Callus, score: 74.581 N N N N
vg0714748935 C -> G LOC_Os07g25700-LOC_Os07g25710 intergenic_region ; MODIFIER silent_mutation Average:52.23; most accessible tissue: Callus, score: 74.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714748935 NA 5.32E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0714748935 NA 2.53E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 4.00E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.69E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 6.67E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.03E-09 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 2.76E-09 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 5.42E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 6.66E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 7.35E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.84E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 1.19E-06 1.88E-06 mr1245_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 4.75E-06 3.71E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 7.61E-06 7.32E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 4.27E-06 4.27E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 2.06E-08 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.66E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.02E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.09E-08 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.00E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 7.37E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 8.98E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 4.38E-06 4.77E-06 mr1445_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 7.85E-06 4.09E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.53E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 9.25E-06 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.06E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 5.26E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.04E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 2.38E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 7.27E-06 NA mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 4.47E-06 4.12E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 8.37E-06 NA mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 3.49E-06 1.58E-07 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 8.54E-07 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 1.48E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714748935 NA 4.52E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251