\
| Variant ID: vg0714480545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14480545 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )
GGATATTGGATGAAGCCGAAAAGAGAACTAGGAGCAAAGTGTGGCGTATGTACAAAGTACAATGGAGTAATCACACCAAGGATGAAGCCACTTGGGAGAG[C/T]
GAAGAATTCTTGAGGATGGAATACCCGCATCTATTCGAAAACAGGTAAGAAAATCTCGGGACGAGATTTATTTAAGGGGGGTAGGTTTGTAACACCCTGA
TCAGGGTGTTACAAACCTACCCCCCTTAAATAAATCTCGTCCCGAGATTTTCTTACCTGTTTTCGAATAGATGCGGGTATTCCATCCTCAAGAATTCTTC[G/A]
CTCTCCCAAGTGGCTTCATCCTTGGTGTGATTACTCCATTGTACTTTGTACATACGCCACACTTTGCTCCTAGTTCTCTTTTCGGCTTCATCCAATATCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.80% | 17.60% | 6.20% | 49.43% | NA |
| All Indica | 2759 | 2.80% | 26.20% | 9.28% | 61.65% | NA |
| All Japonica | 1512 | 69.50% | 0.50% | 0.66% | 29.30% | NA |
| Aus | 269 | 7.10% | 30.50% | 8.92% | 53.53% | NA |
| Indica I | 595 | 4.20% | 12.80% | 10.08% | 72.94% | NA |
| Indica II | 465 | 3.90% | 35.50% | 8.60% | 52.04% | NA |
| Indica III | 913 | 0.80% | 26.90% | 5.59% | 66.70% | NA |
| Indica Intermediate | 786 | 3.60% | 30.20% | 13.36% | 52.93% | NA |
| Temperate Japonica | 767 | 63.40% | 0.40% | 0.52% | 35.72% | NA |
| Tropical Japonica | 504 | 93.50% | 0.60% | 0.60% | 5.36% | NA |
| Japonica Intermediate | 241 | 39.00% | 0.80% | 1.24% | 58.92% | NA |
| VI/Aromatic | 96 | 80.20% | 0.00% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 44.40% | 20.00% | 3.33% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714480545 | C -> DEL | LOC_Os07g25340.1 | N | frameshift_variant | Average:11.982; most accessible tissue: Callus, score: 52.441 | N | N | N | N |
| vg0714480545 | C -> T | LOC_Os07g25340.1 | synonymous_variant ; p.Ser1358Ser; LOW | synonymous_codon | Average:11.982; most accessible tissue: Callus, score: 52.441 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714480545 | 4.72E-06 | 5.34E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 4.58E-06 | 3.94E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 1.64E-07 | 1.13E-06 | mr1117 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 6.23E-06 | 6.04E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 3.78E-06 | 1.49E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 7.73E-08 | 2.25E-07 | mr1114_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 9.54E-10 | 2.05E-09 | mr1117_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 4.03E-06 | 2.22E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 4.08E-07 | 6.89E-07 | mr1120_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 8.10E-07 | 1.57E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 1.51E-07 | 2.09E-07 | mr1240_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 2.61E-07 | 4.99E-08 | mr1242_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 1.17E-06 | 1.22E-06 | mr1247_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 3.83E-08 | 2.53E-08 | mr1496_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714480545 | 1.59E-06 | 1.05E-06 | mr1936_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |