Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0714415544:

Variant ID: vg0714415544 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14415544
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

AACTCAGGAGTCATGCACATATAAAACACTATATGCCTAAAACACGTTGTAACTTGTAAAATCTATAAGAAAATCATTATAACTCCAAAAATTGTGAAAC[A/C]
AAATGTGTTAGTCTTAGAAAACACATCTCCACACCCCTGTGAAGTATAATCTAATAAAAATCACTTTACAAAAGTATTTCATAACACTACCTAAGACTAT

Reverse complement sequence

ATAGTCTTAGGTAGTGTTATGAAATACTTTTGTAAAGTGATTTTTATTAGATTATACTTCACAGGGGTGTGGAGATGTGTTTTCTAAGACTAACACATTT[T/G]
GTTTCACAATTTTTGGAGTTATAATGATTTTCTTATAGATTTTACAAGTTACAACGTGTTTTAGGCATATAGTGTTTTATATGTGCATGACTCCTGAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	1.10%	4.59%	5.61%	NA
All Indica	2759	82.80%	1.40%	6.60%	9.17%	NA
All Japonica	1512	99.00%	0.20%	0.46%	0.33%	NA
Aus	269	88.50%	1.50%	8.18%	1.86%	NA
Indica I	595	84.40%	0.50%	5.38%	9.75%	NA
Indica II	465	79.60%	0.90%	8.17%	11.40%	NA
Indica III	913	83.10%	3.00%	7.34%	6.57%	NA
Indica Intermediate	786	83.10%	0.80%	5.73%	10.43%	NA
Temperate Japonica	767	99.20%	0.00%	0.26%	0.52%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	0.80%	2.07%	0.41%	NA
VI/Aromatic	96	91.70%	4.20%	4.17%	0.00%	NA
Intermediate	90	94.40%	1.10%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714415544	A -> DEL	N	N	silent_mutation	Average:20.394; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0714415544	A -> C	LOC_Os07g25210.1	upstream_gene_variant ; 2138.0bp to feature; MODIFIER	silent_mutation	Average:20.394; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0714415544	A -> C	LOC_Os07g25220.1	upstream_gene_variant ; 2916.0bp to feature; MODIFIER	silent_mutation	Average:20.394; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0714415544	A -> C	LOC_Os07g25210-LOC_Os07g25220	intergenic_region ; MODIFIER	silent_mutation	Average:20.394; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714415544	NA	2.74E-06	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714415544	3.81E-06	3.01E-07	mr1574	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251