\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714249785:

Variant ID: vg0714249785 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14249785
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAGACGAAGATGTTCTTCATGCTCTTCTTTAGTTTAGGAATATATGAGAATGTCATCAATAAAGACAACCACGAACTTATCCAGGTATTCCATGAACA[C/T]
CTTGTTCATCAAGTTCATGAAGAAAGCAGGGGCATTGGTAAGTCCAAAAGACATAACTGTACATTCAAATAGCCCATACCGAGTAGTAAAAGCTGTCTTA

Reverse complement sequence

TAAGACAGCTTTTACTACTCGGTATGGGCTATTTGAATGTACAGTTATGTCTTTTGGACTTACCAATGCCCCTGCTTTCTTCATGAACTTGATGAACAAG[G/A]
TGTTCATGGAATACCTGGATAAGTTCGTGGTTGTCTTTATTGATGACATTCTCATATATTCCTAAACTAAAGAAGAGCATGAAGAACATCTTCGTCTTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 7.60% 10.81% 27.27% NA
All Indica  2759 52.00% 3.40% 12.79% 31.82% NA
All Japonica  1512 61.50% 13.20% 9.26% 16.07% NA
Aus  269 21.90% 22.30% 2.23% 53.53% NA
Indica I  595 54.60% 0.00% 13.78% 31.60% NA
Indica II  465 60.20% 2.20% 12.47% 25.16% NA
Indica III  913 42.40% 4.90% 12.49% 40.20% NA
Indica Intermediate  786 56.20% 5.00% 12.60% 26.21% NA
Temperate Japonica  767 83.60% 0.10% 1.69% 14.60% NA
Tropical Japonica  504 25.20% 38.10% 19.84% 16.87% NA
Japonica Intermediate  241 67.20% 2.50% 11.20% 19.09% NA
VI/Aromatic  96 88.50% 1.00% 2.08% 8.33% NA
Intermediate  90 65.60% 5.60% 11.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714249785 C -> DEL N N silent_mutation Average:6.279; most accessible tissue: Callus, score: 18.544 N N N N
vg0714249785 C -> T LOC_Os07g25000.1 downstream_gene_variant ; 3931.0bp to feature; MODIFIER silent_mutation Average:6.279; most accessible tissue: Callus, score: 18.544 N N N N
vg0714249785 C -> T LOC_Os07g25010.1 intron_variant ; MODIFIER silent_mutation Average:6.279; most accessible tissue: Callus, score: 18.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714249785 5.47E-07 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 1.39E-06 NA mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 5.67E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 2.72E-06 1.94E-07 mr1082 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 6.08E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 2.30E-07 3.85E-07 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 2.44E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 2.25E-07 NA mr1226 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 1.18E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 1.37E-07 NA mr1411 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 3.12E-06 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 5.37E-07 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 8.43E-06 NA mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 3.02E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 7.32E-07 NA mr1878 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 1.82E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 7.31E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 4.87E-06 NA mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 2.18E-06 NA mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 6.06E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 5.38E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 6.23E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 5.46E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 1.99E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 1.56E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 5.51E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 6.75E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 3.83E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 1.11E-07 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 1.95E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714249785 NA 3.18E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251