Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714181877:

Variant ID: vg0714181877 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14181877
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGGAAACATCTATATATGGGCCTATTTGTTTTCCAAATACCTACAAACAACCTTGGTGAATCATCTCTTTGATCCTAAATTATATTTTCAAAGAGACAA[T/A]
GAAAGAGAGAGAGAGGGAGTTAAAGTCCAATTTACACCCAAACTTCACCATACCTCTCATCTTCTCCTAGGAAACATCTACATGAGGCCACTAGACAGCC

Reverse complement sequence

GGCTGTCTAGTGGCCTCATGTAGATGTTTCCTAGGAGAAGATGAGAGGTATGGTGAAGTTTGGGTGTAAATTGGACTTTAACTCCCTCTCTCTCTCTTTC[A/T]
TTGTCTCTTTGAAAATATAATTTAGGATCAAAGAGATGATTCACCAAGGTTGTTTGTAGGTATTTGGAAAACAAATAGGCCCATATATAGATGTTTCCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	28.50%	0.99%	20.82%	NA
All Indica	2759	71.50%	19.20%	1.63%	7.72%	NA
All Japonica	1512	2.60%	50.20%	0.07%	47.16%	NA
Aus	269	75.50%	11.20%	0.37%	13.01%	NA
Indica I	595	43.70%	42.40%	1.68%	12.27%	NA
Indica II	465	68.60%	19.80%	3.87%	7.74%	NA
Indica III	913	97.20%	1.00%	0.44%	1.42%	NA
Indica Intermediate	786	64.40%	22.40%	1.65%	11.58%	NA
Temperate Japonica	767	1.40%	72.60%	0.13%	25.81%	NA
Tropical Japonica	504	2.00%	19.60%	0.00%	78.37%	NA
Japonica Intermediate	241	7.50%	42.70%	0.00%	49.79%	NA
VI/Aromatic	96	92.70%	1.00%	0.00%	6.25%	NA
Intermediate	90	50.00%	31.10%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714181877	T -> DEL	N	N	silent_mutation	Average:8.458; most accessible tissue: Callus, score: 21.861	N	N	N	N
vg0714181877	T -> A	LOC_Os07g24930-LOC_Os07g24940	intergenic_region ; MODIFIER	silent_mutation	Average:8.458; most accessible tissue: Callus, score: 21.861	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714181877	NA	2.60E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	4.02E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	8.86E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	1.35E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	3.62E-18	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	7.16E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	1.74E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	2.19E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	7.42E-07	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	7.72E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	1.74E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	6.82E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	8.54E-09	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	6.63E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	3.22E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	2.99E-15	mr1636_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	4.02E-14	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	1.01E-09	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	7.23E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	5.11E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	7.29E-16	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	9.09E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	2.31E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	3.84E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	1.80E-14	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	1.16E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	6.56E-09	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877	NA	7.38E-15	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251