\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714181877:

Variant ID: vg0714181877 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14181877
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGAAACATCTATATATGGGCCTATTTGTTTTCCAAATACCTACAAACAACCTTGGTGAATCATCTCTTTGATCCTAAATTATATTTTCAAAGAGACAA[T/A]
GAAAGAGAGAGAGAGGGAGTTAAAGTCCAATTTACACCCAAACTTCACCATACCTCTCATCTTCTCCTAGGAAACATCTACATGAGGCCACTAGACAGCC

Reverse complement sequence

GGCTGTCTAGTGGCCTCATGTAGATGTTTCCTAGGAGAAGATGAGAGGTATGGTGAAGTTTGGGTGTAAATTGGACTTTAACTCCCTCTCTCTCTCTTTC[A/T]
TTGTCTCTTTGAAAATATAATTTAGGATCAAAGAGATGATTCACCAAGGTTGTTTGTAGGTATTTGGAAAACAAATAGGCCCATATATAGATGTTTCCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 28.50% 0.99% 20.82% NA
All Indica  2759 71.50% 19.20% 1.63% 7.72% NA
All Japonica  1512 2.60% 50.20% 0.07% 47.16% NA
Aus  269 75.50% 11.20% 0.37% 13.01% NA
Indica I  595 43.70% 42.40% 1.68% 12.27% NA
Indica II  465 68.60% 19.80% 3.87% 7.74% NA
Indica III  913 97.20% 1.00% 0.44% 1.42% NA
Indica Intermediate  786 64.40% 22.40% 1.65% 11.58% NA
Temperate Japonica  767 1.40% 72.60% 0.13% 25.81% NA
Tropical Japonica  504 2.00% 19.60% 0.00% 78.37% NA
Japonica Intermediate  241 7.50% 42.70% 0.00% 49.79% NA
VI/Aromatic  96 92.70% 1.00% 0.00% 6.25% NA
Intermediate  90 50.00% 31.10% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714181877 T -> DEL N N silent_mutation Average:8.458; most accessible tissue: Callus, score: 21.861 N N N N
vg0714181877 T -> A LOC_Os07g24930-LOC_Os07g24940 intergenic_region ; MODIFIER silent_mutation Average:8.458; most accessible tissue: Callus, score: 21.861 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714181877 NA 2.60E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 4.02E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 8.86E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 1.35E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 3.62E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 7.16E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 1.74E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 2.19E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 7.42E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 7.72E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 1.74E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 6.82E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 8.54E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 6.63E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 3.22E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 2.99E-15 mr1636_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 4.02E-14 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 1.01E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 7.23E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 5.11E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 7.29E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 9.09E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 2.31E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 3.84E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 1.80E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 1.16E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 6.56E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714181877 NA 7.38E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251