\
| Variant ID: vg0714165056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14165056 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACGGAAGGTCTTCACGATCACTAGTCAACGTCACGCGAACACGACACTTCTCCTCGTTGGGGTCATGGGGAATCTGGCGATACTCGGGGGCAACCTCGTA[A/G]
CCTACTTCAAATGCCATCATTCTCAGCTCCCTGACGAATCCTAGCACCTCGATCAAGTTTTTCGGCGGATGGGCATCTAAAGCAACATGGAAAGGAAGGA
TCCTTCCTTTCCATGTTGCTTTAGATGCCCATCCGCCGAAAAACTTGATCGAGGTGCTAGGATTCGTCAGGGAGCTGAGAATGATGGCATTTGAAGTAGG[T/C]
TACGAGGTTGCCCCCGAGTATCGCCAGATTCCCCATGACCCCAACGAGGAGAAGTGTCGTGTTCGCGTGACGTTGACTAGTGATCGTGAAGACCTTCCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.20% | 27.80% | 1.06% | 10.88% | NA |
| All Indica | 2759 | 80.10% | 19.00% | 0.54% | 0.33% | NA |
| All Japonica | 1512 | 20.30% | 48.70% | 1.98% | 28.97% | NA |
| Aus | 269 | 87.70% | 10.40% | 0.37% | 1.49% | NA |
| Indica I | 595 | 57.30% | 41.50% | 0.84% | 0.34% | NA |
| Indica II | 465 | 78.90% | 19.80% | 0.65% | 0.65% | NA |
| Indica III | 913 | 98.60% | 1.20% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 76.70% | 22.10% | 0.76% | 0.38% | NA |
| Temperate Japonica | 767 | 4.00% | 72.10% | 1.04% | 22.82% | NA |
| Tropical Japonica | 504 | 46.00% | 17.30% | 3.57% | 33.13% | NA |
| Japonica Intermediate | 241 | 18.30% | 40.20% | 1.66% | 39.83% | NA |
| VI/Aromatic | 96 | 38.50% | 1.00% | 3.12% | 57.29% | NA |
| Intermediate | 90 | 61.10% | 28.90% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714165056 | A -> DEL | LOC_Os07g24910.1 | N | frameshift_variant | Average:11.635; most accessible tissue: Callus, score: 35.383 | N | N | N | N |
| vg0714165056 | A -> G | LOC_Os07g24910.1 | synonymous_variant ; p.Gly7Gly; LOW | synonymous_codon | Average:11.635; most accessible tissue: Callus, score: 35.383 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714165056 | NA | 9.23E-11 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714165056 | NA | 9.29E-10 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714165056 | NA | 2.06E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714165056 | NA | 1.21E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714165056 | NA | 4.96E-11 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714165056 | 2.58E-06 | NA | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714165056 | NA | 7.52E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |