\
| Variant ID: vg0714142381 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14142381 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGATGATGTGACTTGCCTTGCTAAGAGAGAACGGCCTTCCGAACCTTCGGCGACGACCGCGAACCATGCTTCGAGAACCTTCGGAACGACAGAAGCTACG[C/T]
GAAGCACACAAGCAAAGCTAAACCCTATAAAGAAGCAATAACAATACATAAAAAGAAAGCACACGGTTCTTTAGGTTATAACAAACATTAGGAGACTTGA
TCAAGTCTCCTAATGTTTGTTATAACCTAAAGAACCGTGTGCTTTCTTTTTATGTATTGTTATTGCTTCTTTATAGGGTTTAGCTTTGCTTGTGTGCTTC[G/A]
CGTAGCTTCTGTCGTTCCGAAGGTTCTCGAAGCATGGTTCGCGGTCGTCGCCGAAGGTTCGGAAGGCCGTTCTCTCTTAGCAAGGCAAGTCACATCATCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 6.90% | 20.78% | 11.07% | NA |
| All Indica | 2759 | 56.90% | 1.70% | 26.89% | 14.46% | NA |
| All Japonica | 1512 | 60.90% | 17.70% | 13.49% | 7.87% | NA |
| Aus | 269 | 95.50% | 1.10% | 2.97% | 0.37% | NA |
| Indica I | 595 | 59.80% | 0.70% | 19.33% | 20.17% | NA |
| Indica II | 465 | 51.00% | 1.30% | 28.82% | 18.92% | NA |
| Indica III | 913 | 56.00% | 3.20% | 31.00% | 9.86% | NA |
| Indica Intermediate | 786 | 59.40% | 1.00% | 26.72% | 12.85% | NA |
| Temperate Japonica | 767 | 84.90% | 1.40% | 4.17% | 9.52% | NA |
| Tropical Japonica | 504 | 25.20% | 37.10% | 29.37% | 8.33% | NA |
| Japonica Intermediate | 241 | 59.30% | 29.00% | 9.96% | 1.66% | NA |
| VI/Aromatic | 96 | 89.60% | 2.10% | 7.29% | 1.04% | NA |
| Intermediate | 90 | 64.40% | 8.90% | 23.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714142381 | C -> DEL | N | N | silent_mutation | Average:5.321; most accessible tissue: Minghui63 flower, score: 7.958 | N | N | N | N |
| vg0714142381 | C -> T | LOC_Os07g24870.1 | upstream_gene_variant ; 985.0bp to feature; MODIFIER | silent_mutation | Average:5.321; most accessible tissue: Minghui63 flower, score: 7.958 | N | N | N | N |
| vg0714142381 | C -> T | LOC_Os07g24850-LOC_Os07g24870 | intergenic_region ; MODIFIER | silent_mutation | Average:5.321; most accessible tissue: Minghui63 flower, score: 7.958 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714142381 | 5.06E-08 | 5.06E-08 | mr1159_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714142381 | 6.59E-06 | 1.54E-07 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |