| Variant ID: vg0714102855 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14102855 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGAAAGGTTGCCCTCGTTCTCCCATCCTAGCGACGAACCTACTCAGTGCCGCCATGCATCCGGTTAGCTTTTGTACTTCCTTGAGTCTTGTGGGTGACTT[C/T]
ATGTTCTCGATTGCCTTGATCTTCTCGGGATTTGCTTCTATTCCTCTGCCAGAAACAAGGAATCCAAGCAGCTTGCCCGACGGTACTCCGAACGTGCACT
AGTGCACGTTCGGAGTACCGTCGGGCAAGCTGCTTGGATTCCTTGTTTCTGGCAGAGGAATAGAAGCAAATCCCGAGAAGATCAAGGCAATCGAGAACAT[G/A]
AAGTCACCCACAAGACTCAAGGAAGTACAAAAGCTAACCGGATGCATGGCGGCACTGAGTAGGTTCGTCGCTAGGATGGGAGAACGAGGGCAACCTTTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 16.90% | 22.83% | 2.64% | NA |
| All Indica | 2759 | 38.80% | 27.20% | 33.85% | 0.14% | NA |
| All Japonica | 1512 | 85.70% | 1.80% | 4.56% | 7.94% | NA |
| Aus | 269 | 76.60% | 4.80% | 18.59% | 0.00% | NA |
| Indica I | 595 | 61.50% | 9.10% | 29.41% | 0.00% | NA |
| Indica II | 465 | 28.20% | 25.20% | 46.24% | 0.43% | NA |
| Indica III | 913 | 28.10% | 41.80% | 29.90% | 0.11% | NA |
| Indica Intermediate | 786 | 40.30% | 25.10% | 34.48% | 0.13% | NA |
| Temperate Japonica | 767 | 87.40% | 0.50% | 3.00% | 9.13% | NA |
| Tropical Japonica | 504 | 93.70% | 0.80% | 4.96% | 0.60% | NA |
| Japonica Intermediate | 241 | 63.90% | 7.90% | 8.71% | 19.50% | NA |
| VI/Aromatic | 96 | 94.80% | 3.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 7.80% | 26.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714102855 | C -> DEL | LOC_Os07g24810.1 | N | frameshift_variant | Average:9.354; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0714102855 | C -> T | LOC_Os07g24810.1 | missense_variant ; p.Met257Ile; MODERATE | nonsynonymous_codon ; M257I | Average:9.354; most accessible tissue: Minghui63 root, score: 13.235 | benign |
0.494 |
DELETERIOUS | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714102855 | NA | 1.57E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714102855 | NA | 8.10E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714102855 | NA | 3.01E-06 | mr1783 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714102855 | NA | 7.66E-06 | mr1821 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714102855 | NA | 2.67E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714102855 | NA | 1.41E-07 | mr1925 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |