\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714102855:

Variant ID: vg0714102855 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14102855
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAAGGTTGCCCTCGTTCTCCCATCCTAGCGACGAACCTACTCAGTGCCGCCATGCATCCGGTTAGCTTTTGTACTTCCTTGAGTCTTGTGGGTGACTT[C/T]
ATGTTCTCGATTGCCTTGATCTTCTCGGGATTTGCTTCTATTCCTCTGCCAGAAACAAGGAATCCAAGCAGCTTGCCCGACGGTACTCCGAACGTGCACT

Reverse complement sequence

AGTGCACGTTCGGAGTACCGTCGGGCAAGCTGCTTGGATTCCTTGTTTCTGGCAGAGGAATAGAAGCAAATCCCGAGAAGATCAAGGCAATCGAGAACAT[G/A]
AAGTCACCCACAAGACTCAAGGAAGTACAAAAGCTAACCGGATGCATGGCGGCACTGAGTAGGTTCGTCGCTAGGATGGGAGAACGAGGGCAACCTTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 16.90% 22.83% 2.64% NA
All Indica  2759 38.80% 27.20% 33.85% 0.14% NA
All Japonica  1512 85.70% 1.80% 4.56% 7.94% NA
Aus  269 76.60% 4.80% 18.59% 0.00% NA
Indica I  595 61.50% 9.10% 29.41% 0.00% NA
Indica II  465 28.20% 25.20% 46.24% 0.43% NA
Indica III  913 28.10% 41.80% 29.90% 0.11% NA
Indica Intermediate  786 40.30% 25.10% 34.48% 0.13% NA
Temperate Japonica  767 87.40% 0.50% 3.00% 9.13% NA
Tropical Japonica  504 93.70% 0.80% 4.96% 0.60% NA
Japonica Intermediate  241 63.90% 7.90% 8.71% 19.50% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 64.40% 7.80% 26.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714102855 C -> DEL LOC_Os07g24810.1 N frameshift_variant Average:9.354; most accessible tissue: Minghui63 root, score: 13.235 N N N N
vg0714102855 C -> T LOC_Os07g24810.1 missense_variant ; p.Met257Ile; MODERATE nonsynonymous_codon ; M257I Average:9.354; most accessible tissue: Minghui63 root, score: 13.235 benign 0.494 DELETERIOUS 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714102855 NA 1.57E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714102855 NA 8.10E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714102855 NA 3.01E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714102855 NA 7.66E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714102855 NA 2.67E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714102855 NA 1.41E-07 mr1925 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251