Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713900800:

Variant ID: vg0713900800 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13900800
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGTTGCAAAAATATCAAATTGCTTTTCATGCTAGTTTGATGTTTAACATGATTTCTGCTAAAAAGTTGAAACAACCTCATGATGTTTTGGATTGCTCA[G/A]
CATGTAATTTGAATAAGATGAAACTAAAAGATGCTTTAGGTCGTGTTGAGTACATAGAAGATGTTGTGAAAAACAATGAAGTGGTTTTCTTGCCCCAAAT

Reverse complement sequence

ATTTGGGGCAAGAAAACCACTTCATTGTTTTTCACAACATCTTCTATGTACTCAACACGACCTAAAGCATCTTTTAGTTTCATCTTATTCAAATTACATG[C/T]
TGAGCAATCCAAAACATCATGAGGTTGTTTCAACTTTTTAGCAGAAATCATGTTAAACATCAAACTAGCATGAAAAGCAATTTGATATTTTTGCAACAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 29.90% 2.24% 8.46% NA
All Indica  2759 85.70% 6.70% 1.99% 5.55% NA
All Japonica  1512 4.80% 78.70% 2.91% 13.62% NA
Aus  269 85.10% 1.90% 1.86% 11.15% NA
Indica I  595 71.80% 16.00% 3.70% 8.57% NA
Indica II  465 91.60% 3.00% 0.43% 4.95% NA
Indica III  913 97.70% 0.40% 0.33% 1.53% NA
Indica Intermediate  786 78.90% 9.30% 3.56% 8.27% NA
Temperate Japonica  767 5.20% 78.20% 3.52% 13.04% NA
Tropical Japonica  504 1.20% 91.90% 0.79% 6.15% NA
Japonica Intermediate  241 10.80% 52.70% 5.39% 31.12% NA
VI/Aromatic  96 92.70% 1.00% 0.00% 6.25% NA
Intermediate  90 57.80% 34.40% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713900800 G -> DEL N N silent_mutation Average:26.011; most accessible tissue: Callus, score: 39.365 N N N N
vg0713900800 G -> A LOC_Os07g24400.1 downstream_gene_variant ; 3812.0bp to feature; MODIFIER silent_mutation Average:26.011; most accessible tissue: Callus, score: 39.365 N N N N
vg0713900800 G -> A LOC_Os07g24410.1 downstream_gene_variant ; 150.0bp to feature; MODIFIER silent_mutation Average:26.011; most accessible tissue: Callus, score: 39.365 N N N N
vg0713900800 G -> A LOC_Os07g24420.1 downstream_gene_variant ; 4987.0bp to feature; MODIFIER silent_mutation Average:26.011; most accessible tissue: Callus, score: 39.365 N N N N
vg0713900800 G -> A LOC_Os07g24410-LOC_Os07g24420 intergenic_region ; MODIFIER silent_mutation Average:26.011; most accessible tissue: Callus, score: 39.365 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713900800 NA 2.18E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 5.34E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 2.97E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 1.50E-16 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 2.82E-13 mr1905 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 1.27E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 9.71E-06 9.71E-06 mr1973 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 4.63E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 1.98E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 5.19E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 3.52E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 5.12E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800 NA 7.31E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251