Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0713900800:

Variant ID: vg0713900800 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 13900800
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGTTGCAAAAATATCAAATTGCTTTTCATGCTAGTTTGATGTTTAACATGATTTCTGCTAAAAAGTTGAAACAACCTCATGATGTTTTGGATTGCTCA[G/A]
CATGTAATTTGAATAAGATGAAACTAAAAGATGCTTTAGGTCGTGTTGAGTACATAGAAGATGTTGTGAAAAACAATGAAGTGGTTTTCTTGCCCCAAAT

Reverse complement sequence

ATTTGGGGCAAGAAAACCACTTCATTGTTTTTCACAACATCTTCTATGTACTCAACACGACCTAAAGCATCTTTTAGTTTCATCTTATTCAAATTACATG[C/T]
TGAGCAATCCAAAACATCATGAGGTTGTTTCAACTTTTTAGCAGAAATCATGTTAAACATCAAACTAGCATGAAAAGCAATTTGATATTTTTGCAACAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	29.90%	2.24%	8.46%	NA
All Indica	2759	85.70%	6.70%	1.99%	5.55%	NA
All Japonica	1512	4.80%	78.70%	2.91%	13.62%	NA
Aus	269	85.10%	1.90%	1.86%	11.15%	NA
Indica I	595	71.80%	16.00%	3.70%	8.57%	NA
Indica II	465	91.60%	3.00%	0.43%	4.95%	NA
Indica III	913	97.70%	0.40%	0.33%	1.53%	NA
Indica Intermediate	786	78.90%	9.30%	3.56%	8.27%	NA
Temperate Japonica	767	5.20%	78.20%	3.52%	13.04%	NA
Tropical Japonica	504	1.20%	91.90%	0.79%	6.15%	NA
Japonica Intermediate	241	10.80%	52.70%	5.39%	31.12%	NA
VI/Aromatic	96	92.70%	1.00%	0.00%	6.25%	NA
Intermediate	90	57.80%	34.40%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0713900800	G -> DEL	N	N	silent_mutation	Average:26.011; most accessible tissue: Callus, score: 39.365	N	N	N	N
vg0713900800	G -> A	LOC_Os07g24400.1	downstream_gene_variant ; 3812.0bp to feature; MODIFIER	silent_mutation	Average:26.011; most accessible tissue: Callus, score: 39.365	N	N	N	N
vg0713900800	G -> A	LOC_Os07g24410.1	downstream_gene_variant ; 150.0bp to feature; MODIFIER	silent_mutation	Average:26.011; most accessible tissue: Callus, score: 39.365	N	N	N	N
vg0713900800	G -> A	LOC_Os07g24420.1	downstream_gene_variant ; 4987.0bp to feature; MODIFIER	silent_mutation	Average:26.011; most accessible tissue: Callus, score: 39.365	N	N	N	N
vg0713900800	G -> A	LOC_Os07g24410-LOC_Os07g24420	intergenic_region ; MODIFIER	silent_mutation	Average:26.011; most accessible tissue: Callus, score: 39.365	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0713900800	NA	2.18E-17	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	5.34E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	2.97E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	1.50E-16	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	2.82E-13	mr1905	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	1.27E-09	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	9.71E-06	9.71E-06	mr1973	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	4.63E-26	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	1.98E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	5.19E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	3.52E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	5.12E-21	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713900800	NA	7.31E-20	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251