| Variant ID: vg0713713694 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13713694 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTTTTTGTGAATTTGGTCAAATTTTATTCAAATTCATTCAAATTTTAGAATAATTTTGGCTCGAAATTTCCGAAATTTCATTAATTTCGGTAACCCCC[A/G]
GCATAATATTCAATTTCGAAATTGAAAACCCTGACCTTAGGTTGGATATATAGGAACATGATTTTTAATACAATAGTAGAAAAAAAAGAATGATATATAG
CTATATATCATTCTTTTTTTTCTACTATTGTATTAAAAATCATGTTCCTATATATCCAACCTAAGGTCAGGGTTTTCAATTTCGAAATTGAATATTATGC[T/C]
GGGGGTTACCGAAATTAATGAAATTTCGGAAATTTCGAGCCAAAATTATTCTAAAATTTGAATGAATTTGAATAAAATTTGACCAAATTCACAAAAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 20.80% | 3.11% | 3.20% | NA |
| All Indica | 2759 | 88.20% | 5.00% | 4.64% | 2.17% | NA |
| All Japonica | 1512 | 43.80% | 54.70% | 0.99% | 0.46% | NA |
| Aus | 269 | 95.20% | 0.00% | 0.00% | 4.83% | NA |
| Indica I | 595 | 90.90% | 1.00% | 7.56% | 0.50% | NA |
| Indica II | 465 | 92.00% | 3.00% | 4.73% | 0.22% | NA |
| Indica III | 913 | 90.40% | 1.80% | 3.61% | 4.27% | NA |
| Indica Intermediate | 786 | 81.40% | 12.80% | 3.56% | 2.16% | NA |
| Temperate Japonica | 767 | 23.50% | 74.60% | 1.83% | 0.13% | NA |
| Tropical Japonica | 504 | 84.90% | 14.70% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 22.80% | 75.10% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 25.00% | 2.10% | 3.12% | 69.79% | NA |
| Intermediate | 90 | 74.40% | 20.00% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713713694 | A -> DEL | N | N | silent_mutation | Average:25.469; most accessible tissue: Callus, score: 55.065 | N | N | N | N |
| vg0713713694 | A -> G | LOC_Os07g24150-LOC_Os07g24160 | intergenic_region ; MODIFIER | silent_mutation | Average:25.469; most accessible tissue: Callus, score: 55.065 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713713694 | NA | 3.50E-13 | Plant_height | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0713713694 | NA | 1.98E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713713694 | NA | 3.53E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713713694 | NA | 5.45E-06 | mr1405_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713713694 | NA | 5.61E-10 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713713694 | NA | 6.48E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713713694 | NA | 1.02E-10 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |