\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713522827:

Variant ID: vg0713522827 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13522827
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAATACATACAAGTGTATATTAATTAGATCTCTCGCCGTTTGTCATGTATATATAGTGCGCAAAGTAAGCCCAGGGAACTAACTTGTGCGGCTACTA[C/T]
GTGTGCGAGTATTGCCACTGCCTTGCTGACCAAATCATCACCACAAGAGAGCTCGATGTACGTACAAATAAATTCAAAATTTCATTGCGTACGTATCAAT

Reverse complement sequence

ATTGATACGTACGCAATGAAATTTTGAATTTATTTGTACGTACATCGAGCTCTCTTGTGGTGATGATTTGGTCAGCAAGGCAGTGGCAATACTCGCACAC[G/A]
TAGTAGCCGCACAAGTTAGTTCCCTGGGCTTACTTTGCGCACTATATATACATGACAAACGGCGAGAGATCTAATTAATATACACTTGTATGTATTTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 32.50% 0.70% 7.15% NA
All Indica  2759 81.40% 7.40% 0.47% 10.66% NA
All Japonica  1512 22.20% 76.50% 1.26% 0.00% NA
Aus  269 65.10% 20.10% 0.00% 14.87% NA
Indica I  595 68.40% 0.70% 1.01% 29.92% NA
Indica II  465 87.10% 7.50% 0.43% 4.95% NA
Indica III  913 94.00% 5.70% 0.00% 0.33% NA
Indica Intermediate  786 73.40% 14.50% 0.64% 11.45% NA
Temperate Japonica  767 2.10% 97.00% 0.91% 0.00% NA
Tropical Japonica  504 60.90% 37.30% 1.79% 0.00% NA
Japonica Intermediate  241 5.40% 93.40% 1.24% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 54.40% 40.00% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713522827 C -> DEL N N silent_mutation Average:32.058; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0713522827 C -> T LOC_Os07g23930.1 downstream_gene_variant ; 2426.0bp to feature; MODIFIER silent_mutation Average:32.058; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0713522827 C -> T LOC_Os07g23920.1 intron_variant ; MODIFIER silent_mutation Average:32.058; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713522827 NA 9.33E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 6.19E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 7.70E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 5.08E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 4.38E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 7.73E-11 mr1551 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 3.64E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 6.88E-08 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 7.57E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 5.03E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 1.74E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713522827 NA 1.12E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251