\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713306656:

Variant ID: vg0713306656 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13306656
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTTCTATGTCCCGCTACCTTTGTATGTTTTACATATGCAACAATATATGGAGAAACTCCTAATATCATGGTATAGGATAGATGGAAGGCCATTAATAT[C/T]
TAAGCACTTAAACATGGTTATGGCAATGGAACATACAATGGTTGTTCCAATTTGTGAAAAGCAATAACTAAGTTTTGCAAATTTATAGATTCTCTCTAAT

Reverse complement sequence

ATTAGAGAGAATCTATAAATTTGCAAAACTTAGTTATTGCTTTTCACAAATTGGAACAACCATTGTATGTTCCATTGCCATAACCATGTTTAAGTGCTTA[G/A]
ATATTAATGGCCTTCCATCTATCCTATACCATGATATTAGGAGTTTCTCCATATATTGTTGCATATGTAAAACATACAAAGGTAGCGGGACATAGAAGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 22.40% 0.19% 0.00% NA
All Indica  2759 82.30% 17.50% 0.14% 0.00% NA
All Japonica  1512 71.10% 28.60% 0.26% 0.00% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 68.90% 31.10% 0.00% 0.00% NA
Indica II  465 89.70% 10.30% 0.00% 0.00% NA
Indica III  913 94.20% 5.50% 0.33% 0.00% NA
Indica Intermediate  786 74.40% 25.40% 0.13% 0.00% NA
Temperate Japonica  767 64.10% 35.50% 0.39% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 57.70% 0.41% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713306656 C -> T LOC_Os07g23540.1 downstream_gene_variant ; 966.0bp to feature; MODIFIER silent_mutation Average:25.194; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 N N N N
vg0713306656 C -> T LOC_Os07g23540-LOC_Os07g23550 intergenic_region ; MODIFIER silent_mutation Average:25.194; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713306656 NA 1.11E-07 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 3.53E-06 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 2.71E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 2.09E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 1.39E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 4.95E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 7.06E-09 mr1405_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 4.01E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 1.17E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 1.16E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 8.36E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 1.04E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 4.88E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 7.02E-06 NA mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 1.42E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713306656 NA 3.50E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251