\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713262354:

Variant ID: vg0713262354 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13262354
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGCCAAATGGTCCTTGTCTTCCACAACAAAACCCTCGGGTTGTGCCATGTATACATCCTCATGCAAGTCACCATTAAGAAATGCGGTCTTTACATCCAT[C/A]
TGATGGAGCTCTAAATCATAATGAGCAACAAGTGCCATAACAATTCTAAATGAGTCTTTCTTAGAGACGGGAGAAAAGGTTTCATTATAATCTATTCCAT

Reverse complement sequence

ATGGAATAGATTATAATGAAACCTTTTCTCCCGTCTCTAAGAAAGACTCATTTAGAATTGTTATGGCACTTGTTGCTCATTATGATTTAGAGCTCCATCA[G/T]
ATGGATGTAAAGACCGCATTTCTTAATGGTGACTTGCATGAGGATGTATACATGGCACAACCCGAGGGTTTTGTTGTGGAAGACAAGGACCATTTGGCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 22.70% 13.03% 22.89% NA
All Indica  2759 62.90% 1.50% 10.47% 25.12% NA
All Japonica  1512 5.10% 65.50% 12.50% 16.93% NA
Aus  269 44.20% 0.40% 19.70% 35.69% NA
Indica I  595 30.30% 1.30% 26.55% 41.85% NA
Indica II  465 37.80% 3.90% 12.04% 46.24% NA
Indica III  913 94.20% 0.10% 0.99% 4.71% NA
Indica Intermediate  786 66.00% 1.90% 8.40% 23.66% NA
Temperate Japonica  767 5.10% 63.50% 9.00% 22.43% NA
Tropical Japonica  504 1.40% 82.10% 14.88% 1.59% NA
Japonica Intermediate  241 12.90% 36.90% 18.67% 31.54% NA
VI/Aromatic  96 1.00% 7.30% 65.62% 26.04% NA
Intermediate  90 27.80% 34.40% 24.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713262354 C -> DEL LOC_Os07g23480.1 N frameshift_variant Average:7.343; most accessible tissue: Callus, score: 22.634 N N N N
vg0713262354 C -> A LOC_Os07g23480.1 missense_variant ; p.Gln1645His; MODERATE nonsynonymous_codon ; Q1645H Average:7.343; most accessible tissue: Callus, score: 22.634 possibly damaging 1.706 DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713262354 NA 9.27E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 5.08E-09 5.32E-29 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 7.55E-08 1.11E-20 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 NA 5.10E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 NA 6.38E-07 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 2.62E-07 NA mr1540 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 2.47E-08 2.47E-08 mr1540 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 NA 1.91E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 5.99E-07 5.13E-11 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 5.87E-07 2.48E-15 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 2.35E-06 3.62E-12 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 1.48E-06 NA mr1732 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 2.96E-07 9.21E-08 mr1732 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 NA 2.03E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 1.34E-10 9.05E-31 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 1.28E-08 2.01E-21 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 NA 1.05E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 2.63E-08 1.40E-18 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262354 3.84E-08 3.05E-15 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251